Incidental Mutation 'R5451:Olfr835'
ID434587
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Nameolfactory receptor 835
SynonymsMOR150-3, GA_x6K02T2PVTD-12771995-12772930
MMRRC Submission 043016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5451 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19032735-19037670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19035491 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 123 (Y123H)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: Y123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: Y123H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: Y123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5202 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A G 6: 73,468,867 V233A probably benign Het
Abca12 A G 1: 71,294,917 F1142S possibly damaging Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Calhm2 T A 19: 47,132,875 Y285F possibly damaging Het
Casr T C 16: 36,509,908 T355A probably damaging Het
Clca1 T C 3: 145,027,986 Y63C probably damaging Het
Cntnap5a T C 1: 115,685,143 S3P probably benign Het
Col27a1 G A 4: 63,225,239 G388D probably damaging Het
Cwh43 T C 5: 73,431,913 M447T probably benign Het
Dnah7b G A 1: 46,242,019 G2747S possibly damaging Het
Fam58b T A 11: 78,751,289 Q125L possibly damaging Het
Fbxo7 A G 10: 86,029,037 S51G probably benign Het
Gabbr2 T A 4: 46,684,294 Y660F probably benign Het
Galnt15 A G 14: 32,029,911 E140G probably benign Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm21964 A T 8: 110,109,871 I160F probably damaging Het
Gsap T A 5: 21,217,447 L138Q probably damaging Het
Igflr1 A G 7: 30,566,322 N57S possibly damaging Het
Ighv13-2 A G 12: 114,357,853 F89L probably damaging Het
Irf2bpl A G 12: 86,882,072 V609A probably benign Het
Lingo1 T G 9: 56,620,427 I293L probably damaging Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lsm2 T C 17: 34,982,209 probably benign Het
Map4 C T 9: 110,037,783 probably benign Het
Micall1 T A 15: 79,126,904 probably null Het
Mpp7 T C 18: 7,442,855 D156G probably null Het
Mybbp1a A G 11: 72,448,113 D822G probably damaging Het
Naip2 A G 13: 100,188,860 V180A probably benign Het
Nol10 T A 12: 17,359,102 Y159* probably null Het
Nphp3 A G 9: 104,042,022 T1290A probably benign Het
Olfr1107 T C 2: 87,071,997 I46V probably damaging Het
Olfr1112 T A 2: 87,192,452 V255E probably damaging Het
Pcsk5 T A 19: 17,463,356 Y1290F possibly damaging Het
Rab42 T C 4: 132,302,516 N132D probably benign Het
Rfx3 T G 19: 27,849,959 T76P probably damaging Het
Rps13-ps2 G T 7: 88,530,828 noncoding transcript Het
Slc12a3 A G 8: 94,357,027 D894G possibly damaging Het
Slc25a15 G A 8: 22,389,967 T54I probably benign Het
Slco1c1 A T 6: 141,559,878 Q461L probably benign Het
Slfn5 T G 11: 82,960,086 I403R probably damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Tbc1d32 T A 10: 56,195,475 T318S possibly damaging Het
Tiam2 G T 17: 3,428,996 R668M probably damaging Het
Trgj4 G T 13: 19,342,165 probably benign Het
Trim9 A G 12: 70,346,829 S114P probably benign Het
Trp53i11 T C 2: 93,199,855 L169P possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r190-ps A G 13: 22,144,731 noncoding transcript Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0010:Olfr835 UTSW 9 19035322 missense probably damaging 1.00
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R6805:Olfr835 UTSW 9 19035301 missense probably damaging 1.00
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
R8139:Olfr835 UTSW 9 19035575 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTCTCATTTGCAAACACCCATG -3'
(R):5'- GCTTCATGACCTGAGAAAGTTC -3'

Sequencing Primer
(F):5'- CAGGATCAGAGCATCAGTT -3'
(R):5'- TCATGACCTGAGAAAGTTCACAGAAG -3'
Posted On2016-10-06