Incidental Mutation 'R5451:Tbc1d32'
ID434591
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene NameTBC1 domain family, member 32
SynonymsD630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission 043016-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R5451 (G1)
Quality Score203
Status Validated
Chromosome10
Chromosomal Location56014293-56228689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56195475 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 318 (T318S)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099739
AA Change: T318S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: T318S

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Meta Mutation Damage Score 0.1285 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A G 6: 73,468,867 V233A probably benign Het
Abca12 A G 1: 71,294,917 F1142S possibly damaging Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Calhm2 T A 19: 47,132,875 Y285F possibly damaging Het
Casr T C 16: 36,509,908 T355A probably damaging Het
Clca1 T C 3: 145,027,986 Y63C probably damaging Het
Cntnap5a T C 1: 115,685,143 S3P probably benign Het
Col27a1 G A 4: 63,225,239 G388D probably damaging Het
Cwh43 T C 5: 73,431,913 M447T probably benign Het
Dnah7b G A 1: 46,242,019 G2747S possibly damaging Het
Fam58b T A 11: 78,751,289 Q125L possibly damaging Het
Fbxo7 A G 10: 86,029,037 S51G probably benign Het
Gabbr2 T A 4: 46,684,294 Y660F probably benign Het
Galnt15 A G 14: 32,029,911 E140G probably benign Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm21964 A T 8: 110,109,871 I160F probably damaging Het
Gsap T A 5: 21,217,447 L138Q probably damaging Het
Igflr1 A G 7: 30,566,322 N57S possibly damaging Het
Ighv13-2 A G 12: 114,357,853 F89L probably damaging Het
Irf2bpl A G 12: 86,882,072 V609A probably benign Het
Lingo1 T G 9: 56,620,427 I293L probably damaging Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lsm2 T C 17: 34,982,209 probably benign Het
Map4 C T 9: 110,037,783 probably benign Het
Micall1 T A 15: 79,126,904 probably null Het
Mpp7 T C 18: 7,442,855 D156G probably null Het
Mybbp1a A G 11: 72,448,113 D822G probably damaging Het
Naip2 A G 13: 100,188,860 V180A probably benign Het
Nol10 T A 12: 17,359,102 Y159* probably null Het
Nphp3 A G 9: 104,042,022 T1290A probably benign Het
Olfr1107 T C 2: 87,071,997 I46V probably damaging Het
Olfr1112 T A 2: 87,192,452 V255E probably damaging Het
Olfr835 T C 9: 19,035,491 Y123H probably damaging Het
Pcsk5 T A 19: 17,463,356 Y1290F possibly damaging Het
Rab42 T C 4: 132,302,516 N132D probably benign Het
Rfx3 T G 19: 27,849,959 T76P probably damaging Het
Rps13-ps2 G T 7: 88,530,828 noncoding transcript Het
Slc12a3 A G 8: 94,357,027 D894G possibly damaging Het
Slc25a15 G A 8: 22,389,967 T54I probably benign Het
Slco1c1 A T 6: 141,559,878 Q461L probably benign Het
Slfn5 T G 11: 82,960,086 I403R probably damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Tiam2 G T 17: 3,428,996 R668M probably damaging Het
Trgj4 G T 13: 19,342,165 probably benign Het
Trim9 A G 12: 70,346,829 S114P probably benign Het
Trp53i11 T C 2: 93,199,855 L169P possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r190-ps A G 13: 22,144,731 noncoding transcript Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCCGTGTACAGGTTAAAGGC -3'
(R):5'- AAGAGTGAGTGTGGCTCTTAGC -3'

Sequencing Primer
(F):5'- TGCAGAAAAGCAATTAGAACTCAGC -3'
(R):5'- GAATATCACTGATCTCACACA -3'
Posted On2016-10-06