Incidental Mutation 'R5451:Fbxo7'
ID 434592
Institutional Source Beutler Lab
Gene Symbol Fbxo7
Ensembl Gene ENSMUSG00000001786
Gene Name F-box protein 7
Synonyms 2410015K21Rik, A230052G17Rik
MMRRC Submission 043016-MU
Accession Numbers

NCBI RefSeq: NM_153195.2; MGI: 1917004
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5451 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86021972-86051873 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86029037 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 51 (S51G)
Ref Sequence ENSEMBL: ENSMUSP00000001837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001837] [ENSMUST00000117597] [ENSMUST00000120344] [ENSMUST00000130320] [ENSMUST00000147168]
AlphaFold Q3U7U3
Predicted Effect probably benign
Transcript: ENSMUST00000001837
AA Change: S51G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000001837
Gene: ENSMUSG00000001786
AA Change: S51G

DomainStartEndE-ValueType
Blast:UBQ 1 40 7e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117597
AA Change: E68G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113263
Gene: ENSMUSG00000001786
AA Change: E68G

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 101 245 9.6e-31 PFAM
Pfam:F-box 250 297 2.7e-6 PFAM
Pfam:F-box-like 252 298 7.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120344
AA Change: E70G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113222
Gene: ENSMUSG00000001786
AA Change: E70G

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 103 247 4.8e-31 PFAM
Pfam:F-box 252 299 1.8e-6 PFAM
Pfam:F-box-like 254 300 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130320
AA Change: E149G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120840
Gene: ENSMUSG00000001786
AA Change: E149G

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 78 7e-6 SMART
Blast:UBQ 1 79 6e-30 BLAST
Pfam:PI31_Prot_N 188 323 4.7e-20 PFAM
Pfam:F-box 331 378 9.7e-6 PFAM
Pfam:F-box-like 333 379 9.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134490
Predicted Effect probably benign
Transcript: ENSMUST00000147168
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (52/54)
MGI Phenotype Strain: 4434927
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pro-B cell numbers and increased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A G 6: 73,468,867 V233A probably benign Het
Abca12 A G 1: 71,294,917 F1142S possibly damaging Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Calhm2 T A 19: 47,132,875 Y285F possibly damaging Het
Casr T C 16: 36,509,908 T355A probably damaging Het
Clca1 T C 3: 145,027,986 Y63C probably damaging Het
Cntnap5a T C 1: 115,685,143 S3P probably benign Het
Col27a1 G A 4: 63,225,239 G388D probably damaging Het
Cwh43 T C 5: 73,431,913 M447T probably benign Het
Dnah7b G A 1: 46,242,019 G2747S possibly damaging Het
Fam58b T A 11: 78,751,289 Q125L possibly damaging Het
Gabbr2 T A 4: 46,684,294 Y660F probably benign Het
Galnt15 A G 14: 32,029,911 E140G probably benign Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm21964 A T 8: 110,109,871 I160F probably damaging Het
Gsap T A 5: 21,217,447 L138Q probably damaging Het
Igflr1 A G 7: 30,566,322 N57S possibly damaging Het
Ighv13-2 A G 12: 114,357,853 F89L probably damaging Het
Irf2bpl A G 12: 86,882,072 V609A probably benign Het
Lingo1 T G 9: 56,620,427 I293L probably damaging Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lsm2 T C 17: 34,982,209 probably benign Het
Map4 C T 9: 110,037,783 probably benign Het
Micall1 T A 15: 79,126,904 probably null Het
Mpp7 T C 18: 7,442,855 D156G probably null Het
Mybbp1a A G 11: 72,448,113 D822G probably damaging Het
Naip2 A G 13: 100,188,860 V180A probably benign Het
Nol10 T A 12: 17,359,102 Y159* probably null Het
Nphp3 A G 9: 104,042,022 T1290A probably benign Het
Olfr1107 T C 2: 87,071,997 I46V probably damaging Het
Olfr1112 T A 2: 87,192,452 V255E probably damaging Het
Olfr835 T C 9: 19,035,491 Y123H probably damaging Het
Pcsk5 T A 19: 17,463,356 Y1290F possibly damaging Het
Rab42 T C 4: 132,302,516 N132D probably benign Het
Rfx3 T G 19: 27,849,959 T76P probably damaging Het
Rps13-ps2 G T 7: 88,530,828 noncoding transcript Het
Slc12a3 A G 8: 94,357,027 D894G possibly damaging Het
Slc25a15 G A 8: 22,389,967 T54I probably benign Het
Slco1c1 A T 6: 141,559,878 Q461L probably benign Het
Slfn5 T G 11: 82,960,086 I403R probably damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Tbc1d32 T A 10: 56,195,475 T318S possibly damaging Het
Tiam2 G T 17: 3,428,996 R668M probably damaging Het
Trgj4 G T 13: 19,342,165 probably benign Het
Trim9 A G 12: 70,346,829 S114P probably benign Het
Trp53i11 T C 2: 93,199,855 L169P possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r190-ps A G 13: 22,144,731 noncoding transcript Het
Other mutations in Fbxo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Fbxo7 APN 10 86029064 missense probably damaging 0.98
IGL01483:Fbxo7 APN 10 86044581 missense probably damaging 1.00
IGL02502:Fbxo7 APN 10 86033297 missense probably damaging 1.00
IGL02712:Fbxo7 APN 10 86024438 missense possibly damaging 0.75
P0007:Fbxo7 UTSW 10 86033293 missense possibly damaging 0.95
R0410:Fbxo7 UTSW 10 86029238 critical splice donor site probably null
R4119:Fbxo7 UTSW 10 86021895 unclassified probably benign
R4604:Fbxo7 UTSW 10 86046802 missense probably damaging 1.00
R4884:Fbxo7 UTSW 10 86029150 missense probably damaging 0.99
R5088:Fbxo7 UTSW 10 86021920 unclassified probably benign
R5286:Fbxo7 UTSW 10 86022090 missense probably damaging 1.00
R5387:Fbxo7 UTSW 10 86024654 missense probably benign 0.01
R5491:Fbxo7 UTSW 10 86048026 missense probably damaging 1.00
R5542:Fbxo7 UTSW 10 86033285 missense probably benign 0.00
R5647:Fbxo7 UTSW 10 86029110 missense probably damaging 0.98
R6027:Fbxo7 UTSW 10 86048086 missense probably damaging 1.00
R6152:Fbxo7 UTSW 10 86024696 missense probably benign 0.01
R6280:Fbxo7 UTSW 10 86029105 missense probably benign 0.00
R6615:Fbxo7 UTSW 10 86044534 missense possibly damaging 0.48
R7405:Fbxo7 UTSW 10 86044581 missense probably damaging 1.00
R8785:Fbxo7 UTSW 10 86024546 missense probably benign 0.02
R9743:Fbxo7 UTSW 10 86047909 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTAGCCTGGAGTTATGGGACTC -3'
(R):5'- CCTGAGGAATGTAGCCTGACTC -3'

Sequencing Primer
(F):5'- CCTGGAGTTATGGGACTCAGGAC -3'
(R):5'- GAATGTAGCCTGACTCGAGCATC -3'
Posted On 2016-10-06