Incidental Mutation 'R5451:Nol10'
ID434596
Institutional Source Beutler Lab
Gene Symbol Nol10
Ensembl Gene ENSMUSG00000061458
Gene Namenucleolar protein 10
SynonymsLOC217431
MMRRC Submission 043016-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5451 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17348458-17430095 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 17359102 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 159 (Y159*)
Ref Sequence ENSEMBL: ENSMUSP00000035930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046011]
Predicted Effect probably null
Transcript: ENSMUST00000046011
AA Change: Y159*
SMART Domains Protein: ENSMUSP00000035930
Gene: ENSMUSG00000061458
AA Change: Y159*

DomainStartEndE-ValueType
WD40 42 81 1.1e1 SMART
Blast:WD40 84 123 1e-8 BLAST
WD40 165 204 3.3e1 SMART
WD40 223 257 4.42e1 SMART
WD40 260 299 1.19e1 SMART
WD40 302 340 1.97e2 SMART
low complexity region 451 476 N/A INTRINSIC
Pfam:NUC153 482 509 1.4e-15 PFAM
low complexity region 515 536 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
coiled coil region 557 588 N/A INTRINSIC
low complexity region 650 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175296
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A G 6: 73,468,867 V233A probably benign Het
Abca12 A G 1: 71,294,917 F1142S possibly damaging Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Calhm2 T A 19: 47,132,875 Y285F possibly damaging Het
Casr T C 16: 36,509,908 T355A probably damaging Het
Clca1 T C 3: 145,027,986 Y63C probably damaging Het
Cntnap5a T C 1: 115,685,143 S3P probably benign Het
Col27a1 G A 4: 63,225,239 G388D probably damaging Het
Cwh43 T C 5: 73,431,913 M447T probably benign Het
Dnah7b G A 1: 46,242,019 G2747S possibly damaging Het
Fam58b T A 11: 78,751,289 Q125L possibly damaging Het
Fbxo7 A G 10: 86,029,037 S51G probably benign Het
Gabbr2 T A 4: 46,684,294 Y660F probably benign Het
Galnt15 A G 14: 32,029,911 E140G probably benign Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm21964 A T 8: 110,109,871 I160F probably damaging Het
Gsap T A 5: 21,217,447 L138Q probably damaging Het
Igflr1 A G 7: 30,566,322 N57S possibly damaging Het
Ighv13-2 A G 12: 114,357,853 F89L probably damaging Het
Irf2bpl A G 12: 86,882,072 V609A probably benign Het
Lingo1 T G 9: 56,620,427 I293L probably damaging Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lsm2 T C 17: 34,982,209 probably benign Het
Map4 C T 9: 110,037,783 probably benign Het
Micall1 T A 15: 79,126,904 probably null Het
Mpp7 T C 18: 7,442,855 D156G probably null Het
Mybbp1a A G 11: 72,448,113 D822G probably damaging Het
Naip2 A G 13: 100,188,860 V180A probably benign Het
Nphp3 A G 9: 104,042,022 T1290A probably benign Het
Olfr1107 T C 2: 87,071,997 I46V probably damaging Het
Olfr1112 T A 2: 87,192,452 V255E probably damaging Het
Olfr835 T C 9: 19,035,491 Y123H probably damaging Het
Pcsk5 T A 19: 17,463,356 Y1290F possibly damaging Het
Rab42 T C 4: 132,302,516 N132D probably benign Het
Rfx3 T G 19: 27,849,959 T76P probably damaging Het
Rps13-ps2 G T 7: 88,530,828 noncoding transcript Het
Slc12a3 A G 8: 94,357,027 D894G possibly damaging Het
Slc25a15 G A 8: 22,389,967 T54I probably benign Het
Slco1c1 A T 6: 141,559,878 Q461L probably benign Het
Slfn5 T G 11: 82,960,086 I403R probably damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Tbc1d32 T A 10: 56,195,475 T318S possibly damaging Het
Tiam2 G T 17: 3,428,996 R668M probably damaging Het
Trgj4 G T 13: 19,342,165 probably benign Het
Trim9 A G 12: 70,346,829 S114P probably benign Het
Trp53i11 T C 2: 93,199,855 L169P possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r190-ps A G 13: 22,144,731 noncoding transcript Het
Other mutations in Nol10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Nol10 APN 12 17361129 splice site probably benign
R1769:Nol10 UTSW 12 17416708 splice site probably benign
R1884:Nol10 UTSW 12 17368389 critical splice donor site probably null
R1930:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R1931:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R2010:Nol10 UTSW 12 17416101 missense probably benign 0.00
R2037:Nol10 UTSW 12 17361151 missense probably benign 0.01
R2168:Nol10 UTSW 12 17373584 missense probably damaging 1.00
R3729:Nol10 UTSW 12 17424673 missense probably benign 0.42
R3731:Nol10 UTSW 12 17424673 missense probably benign 0.42
R4368:Nol10 UTSW 12 17379292 missense probably damaging 1.00
R4618:Nol10 UTSW 12 17348561 missense probably damaging 0.98
R4736:Nol10 UTSW 12 17355287 missense probably damaging 1.00
R5342:Nol10 UTSW 12 17369620 splice site probably null
R5536:Nol10 UTSW 12 17416137 nonsense probably null
R5586:Nol10 UTSW 12 17416828 missense possibly damaging 0.73
R6045:Nol10 UTSW 12 17348478 start gained probably benign
R6833:Nol10 UTSW 12 17352727 missense probably benign 0.03
R7039:Nol10 UTSW 12 17429184 missense possibly damaging 0.94
R7189:Nol10 UTSW 12 17373561 critical splice acceptor site probably null
R7251:Nol10 UTSW 12 17402107 missense probably damaging 1.00
R7399:Nol10 UTSW 12 17402173 missense probably damaging 1.00
R7600:Nol10 UTSW 12 17369480 missense probably damaging 0.99
R7650:Nol10 UTSW 12 17362682 critical splice donor site probably null
R7729:Nol10 UTSW 12 17424675 missense possibly damaging 0.62
R7772:Nol10 UTSW 12 17348585 missense probably damaging 1.00
R7869:Nol10 UTSW 12 17358238 missense probably null 0.93
R7972:Nol10 UTSW 12 17352647 missense probably benign 0.15
Z1177:Nol10 UTSW 12 17359088 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACTGCTGGACTGTGTAAGG -3'
(R):5'- AAATGATGGCCCAGGATGC -3'

Sequencing Primer
(F):5'- CTGGACTGTGTAAGGAGATCCC -3'
(R):5'- CCCAGGATGCTGGTTTAATGCAAC -3'
Posted On2016-10-06