Incidental Mutation 'R4922:Fancd2'
ID434628
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission 042524-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4922 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113585473 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1258 (V1258A)
Ref Sequence ENSEMBL: ENSMUSP00000144928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]
Predicted Effect probably benign
Transcript: ENSMUST00000036340
AA Change: V1258A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: V1258A

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124262
Predicted Effect probably benign
Transcript: ENSMUST00000204827
AA Change: V1258A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: V1258A

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 13,986,819 H10R possibly damaging Het
4932438A13Rik T A 3: 36,987,165 I2564K probably damaging Het
5830473C10Rik A G 5: 90,579,711 H396R possibly damaging Het
Adgrb2 G T 4: 130,007,852 C423F probably damaging Het
Akap11 A T 14: 78,512,780 Y722* probably null Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Arfgef3 T A 10: 18,592,186 R1755S probably damaging Het
Atf7ip A T 6: 136,560,041 T91S possibly damaging Het
B020004J07Rik T A 4: 101,835,532 M424L probably benign Het
Bcl2 C A 1: 106,712,646 A79S probably benign Het
Bmp10 C T 6: 87,433,575 P117S probably benign Het
Bmpr2 A G 1: 59,867,424 T559A probably benign Het
Cd200r1 A T 16: 44,789,676 Y86F probably damaging Het
Cemip T A 7: 83,947,100 probably benign Het
Cfap52 A G 11: 67,931,722 probably null Het
Chml T C 1: 175,687,146 H60R possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Clec12a A G 6: 129,359,478 Y201C probably damaging Het
Col15a1 T C 4: 47,258,719 V370A probably benign Het
Cpsf3 T C 12: 21,301,537 I353T probably damaging Het
Csf2rb T A 15: 78,346,467 V470E probably benign Het
Cyp4a10 C A 4: 115,521,094 Q126K probably benign Het
Dennd1b T C 1: 139,085,914 S249P probably damaging Het
Dnase2a A G 8: 84,908,996 probably null Het
Dpp10 T C 1: 123,378,153 N490S probably benign Het
Enc1 C T 13: 97,245,735 A251V probably benign Het
Fancm G A 12: 65,106,892 probably null Het
Fbxo16 C T 14: 65,299,208 T177I probably benign Het
Gm10471 A T 5: 26,084,793 I212N probably damaging Het
Gm1965 T C 6: 89,146,543 noncoding transcript Het
Gm6768 A G 12: 119,262,517 noncoding transcript Het
Hal A T 10: 93,503,539 M497L probably damaging Het
Hectd4 T C 5: 121,359,315 L3936S possibly damaging Het
Hs3st4 G T 7: 124,397,187 G359W probably damaging Het
Il6st C T 13: 112,502,865 P608L probably damaging Het
Kctd18 A C 1: 57,965,548 probably benign Het
Kntc1 T A 5: 123,802,246 S1636T probably damaging Het
Lrrn1 A T 6: 107,568,350 S370C probably damaging Het
Mtcl1 A C 17: 66,348,479 C968G probably benign Het
Mylip G A 13: 45,408,762 A347T probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neu4 T A 1: 94,022,478 V53E probably damaging Het
Nxpe3 T C 16: 55,860,324 I302V probably benign Het
Olfr1229 A T 2: 89,282,467 L243Q possibly damaging Het
Olfr266 A T 3: 106,822,260 C100S probably damaging Het
Otos T C 1: 92,644,368 T79A probably damaging Het
Pde4a T C 9: 21,210,713 I578T probably damaging Het
Prex2 C T 1: 11,169,940 P927S probably damaging Het
Prrxl1 A T 14: 32,608,406 N160I probably damaging Het
Prune2 A T 19: 17,122,752 K1873N probably benign Het
Ptk7 C A 17: 46,576,491 probably null Het
Reln T A 5: 21,995,587 probably null Het
Rgl2 A G 17: 33,932,775 probably benign Het
Rnf145 T A 11: 44,557,236 probably benign Het
Ryr2 T C 13: 11,709,963 E2488G probably damaging Het
Sgo2b A T 8: 63,926,630 M1056K possibly damaging Het
Snapc4 A G 2: 26,369,233 V635A probably benign Het
Snx19 T A 9: 30,437,467 Y101N probably benign Het
Sorl1 C A 9: 42,014,450 probably null Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tmem30b G A 12: 73,545,714 P209L probably damaging Het
Trbv12-2 G T 6: 41,119,147 C52F probably damaging Het
Tsc2 T A 17: 24,600,369 D1304V probably benign Het
Ugt2b36 T C 5: 87,066,324 Y487C probably damaging Het
Vmn1r10 T A 6: 57,113,826 N134K probably damaging Het
Wdr27 C A 17: 14,920,754 probably null Het
Wdr66 T C 5: 123,256,053 V335A probably benign Het
Wdr75 T C 1: 45,816,478 F430L probably damaging Het
Zfp629 A G 7: 127,612,127 I170T probably damaging Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 splice site probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 splice site probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
R7489:Fancd2 UTSW 6 113564304 missense probably benign
R7501:Fancd2 UTSW 6 113548403 missense possibly damaging 0.95
R7504:Fancd2 UTSW 6 113545038 missense probably damaging 1.00
R7992:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R8027:Fancd2 UTSW 6 113546622 missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113568226 missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113572570 missense probably benign 0.00
R8757:Fancd2 UTSW 6 113560093 missense possibly damaging 0.91
R8960:Fancd2 UTSW 6 113563168 critical splice donor site probably null
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113545025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGCTTGTAGCTACGTGG -3'
(R):5'- CCCAAAATGAACAGGGGTCATG -3'

Sequencing Primer
(F):5'- CTACGTGGAAGTAACTGTGTCCC -3'
(R):5'- GGGAGTTAACAGGGCCCG -3'
Posted On2016-10-13