Incidental Mutation 'R4869:Setd1a'
ID 434631
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 042479-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4869 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 127396776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000154987] [ENSMUST00000206674] [ENSMUST00000155005] [ENSMUST00000125188] [ENSMUST00000139068] [ENSMUST00000138432]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: F1574L
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: F1574L

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: F1574L
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: F1574L

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: F1031L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect probably benign
Transcript: ENSMUST00000125188
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Meta Mutation Damage Score 0.4085 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,161,488 (GRCm39) K943N probably damaging Het
Abca13 G A 11: 9,265,434 (GRCm39) probably null Het
Ankub1 A G 3: 57,597,751 (GRCm39) L73P probably damaging Het
Birc6 A G 17: 74,893,007 (GRCm39) I982V probably benign Het
Cabyr G T 18: 12,884,875 (GRCm39) *454L probably null Het
Ccdc57 C T 11: 120,794,344 (GRCm39) probably null Het
Cd209c A G 8: 3,994,077 (GRCm39) F128L probably benign Het
Cdh23 A T 10: 60,212,713 (GRCm39) I1566N probably damaging Het
Cdon T C 9: 35,364,200 (GRCm39) V106A possibly damaging Het
Cebpa G T 7: 34,819,246 (GRCm39) G135C probably damaging Het
Cfap65 A G 1: 74,958,420 (GRCm39) S896P probably benign Het
Ciz1 T C 2: 32,254,247 (GRCm39) S63P probably damaging Het
Clybl G A 14: 122,621,618 (GRCm39) V269M probably damaging Het
Ctnnb1 G T 9: 120,782,060 (GRCm39) V358L possibly damaging Het
Cwh43 G T 5: 73,586,016 (GRCm39) probably null Het
Cyp2d10 G A 15: 82,287,967 (GRCm39) R379C probably benign Het
Dab2ip C A 2: 35,610,049 (GRCm39) R727S probably damaging Het
Dmrt1 T A 19: 25,483,219 (GRCm39) M1K probably null Het
Dock1 A T 7: 134,335,800 (GRCm39) I65F probably damaging Het
Ercc2 T C 7: 19,120,732 (GRCm39) V155A probably damaging Het
Exph5 A C 9: 53,287,539 (GRCm39) D1540A possibly damaging Het
Fat3 T A 9: 16,288,773 (GRCm39) H250L probably damaging Het
Fbxw10 C A 11: 62,753,557 (GRCm39) A517E probably damaging Het
Furin A T 7: 80,046,727 (GRCm39) N176K probably damaging Het
Gabrb3 A G 7: 57,442,207 (GRCm39) probably benign Het
Gabrg2 A T 11: 41,811,231 (GRCm39) S305T probably damaging Het
Gas6 G T 8: 13,525,086 (GRCm39) S299R possibly damaging Het
Gga3 G T 11: 115,477,111 (GRCm39) probably benign Het
Gle1 A G 2: 29,826,032 (GRCm39) E37G possibly damaging Het
Gm7964 A G 7: 83,405,350 (GRCm39) D80G possibly damaging Het
Gne C T 4: 44,055,204 (GRCm39) probably null Het
Grid2 G T 6: 64,406,724 (GRCm39) G695W probably damaging Het
H2-M10.6 A T 17: 37,123,425 (GRCm39) M40L probably benign Het
Hectd4 G T 5: 121,460,735 (GRCm39) V905L possibly damaging Het
Isyna1 C A 8: 71,049,412 (GRCm39) S441R possibly damaging Het
Kcnh3 C T 15: 99,139,913 (GRCm39) S933L probably benign Het
Knl1 T C 2: 118,902,832 (GRCm39) I1511T possibly damaging Het
Krt73 T C 15: 101,704,833 (GRCm39) E351G probably damaging Het
Lipo4 C T 19: 33,478,953 (GRCm39) probably null Het
Llgl1 T A 11: 60,598,036 (GRCm39) L360* probably null Het
Map2k5 G A 9: 63,229,525 (GRCm39) R169* probably null Het
Muc19 A T 15: 91,781,910 (GRCm39) noncoding transcript Het
Muc4 G A 16: 32,754,836 (GRCm38) probably benign Het
Myh4 A G 11: 67,143,490 (GRCm39) E1074G probably damaging Het
Naip5 C T 13: 100,381,639 (GRCm39) G210E probably damaging Het
Nalcn A G 14: 123,837,296 (GRCm39) S23P probably benign Het
Nepro T A 16: 44,550,536 (GRCm39) M176K probably damaging Het
Nlrp6 G A 7: 140,504,006 (GRCm39) C704Y probably damaging Het
Notch1 A G 2: 26,361,191 (GRCm39) S1100P probably benign Het
Nrxn3 A G 12: 88,762,352 (GRCm39) E133G possibly damaging Het
Obi1 A G 14: 104,716,252 (GRCm39) I707T probably damaging Het
Parp9 T C 16: 35,777,274 (GRCm39) L406S probably damaging Het
Peak1 G T 9: 56,134,876 (GRCm39) A155D probably benign Het
Piezo1 G A 8: 123,214,284 (GRCm39) H1628Y probably benign Het
Piwil2 A G 14: 70,632,811 (GRCm39) V587A probably benign Het
Pkn2 A G 3: 142,509,379 (GRCm39) Y722H probably damaging Het
Plch2 A T 4: 155,073,885 (GRCm39) I834K probably benign Het
Pld1 A G 3: 28,163,951 (GRCm39) T795A possibly damaging Het
Plekhh1 A G 12: 79,097,160 (GRCm39) S103G probably benign Het
Ppl T C 16: 4,922,753 (GRCm39) Y246C probably damaging Het
Prpf40b G A 15: 99,207,726 (GRCm39) probably benign Het
Prr14l A G 5: 32,986,177 (GRCm39) L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 (GRCm39) I28F possibly damaging Het
Ptrh2 A T 11: 86,580,631 (GRCm39) K83* probably null Het
Rai1 T C 11: 60,077,588 (GRCm39) S551P probably damaging Het
Rapgefl1 A T 11: 98,741,935 (GRCm39) Q633L probably damaging Het
Rb1cc1 T C 1: 6,285,245 (GRCm39) probably benign Het
Rif1 T A 2: 51,983,623 (GRCm39) probably benign Het
Rnf141 A G 7: 110,424,557 (GRCm39) Y101H probably damaging Het
Rttn T A 18: 89,061,138 (GRCm39) L1102* probably null Het
Sall4 G A 2: 168,597,637 (GRCm39) S401F probably damaging Het
Saxo5 G A 8: 3,537,148 (GRCm39) S498N probably damaging Het
Sec11c T C 18: 65,934,541 (GRCm39) I36T probably benign Het
Sel1l A G 12: 91,780,828 (GRCm39) probably benign Het
Sez6l2 C T 7: 126,561,014 (GRCm39) P433L probably benign Het
Sgf29 T C 7: 126,248,547 (GRCm39) probably benign Het
Slc47a1 A G 11: 61,253,520 (GRCm39) V305A probably benign Het
Slco1a8 T C 6: 141,933,492 (GRCm39) D431G probably damaging Het
Sun2 T C 15: 79,612,587 (GRCm39) probably benign Het
Tecta T C 9: 42,286,830 (GRCm39) S609G probably benign Het
Tmprss6 T A 15: 78,327,880 (GRCm39) probably null Het
Tns1 T C 1: 73,991,774 (GRCm39) H968R probably benign Het
Tomm34 G A 2: 163,896,637 (GRCm39) A270V probably damaging Het
Tpo T C 12: 30,153,364 (GRCm39) K330R probably benign Het
Ttn T A 2: 76,542,837 (GRCm39) Y33383F probably damaging Het
Unc13c G T 9: 73,587,716 (GRCm39) A1439D probably benign Het
Vcp C T 4: 42,993,691 (GRCm39) R147H probably benign Het
Vps13d A G 4: 144,854,612 (GRCm39) L2272P probably damaging Het
Wdfy3 A G 5: 102,042,787 (GRCm39) L1988P probably damaging Het
Wwc2 A G 8: 48,373,713 (GRCm39) F51S probably damaging Het
Zfp454 C T 11: 50,763,980 (GRCm39) C373Y probably damaging Het
Zfp853 A T 5: 143,274,048 (GRCm39) V473E probably damaging Het
Zfp959 A T 17: 56,204,228 (GRCm39) R85S possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTAAGCGCTATTGGCACCTC -3'
(R):5'- GCTACTACTGTCCAGTCAGC -3'

Sequencing Primer
(F):5'- TCAGCCATCATGGACAGTGATCTG -3'
(R):5'- AGTCAGCAACTGGCCTAGTG -3'
Posted On 2016-10-13