Mutagenetix > Incidental Mutation

Incidental Mutation 'R4875:Dnah7c'

434636

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

044392-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.393) question?

Stock #

R4875 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46688925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 2928 (N2928D)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000189749
AA Change: N2928D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: N2928D

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Meta Mutation Damage Score

0.0780

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

95% (57/60)

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak1	A	T	2: 32,631,177	E119D	probably benign	Het
Alox5	A	T	6: 116,413,850		probably null	Het
Atad5	T	C	11: 80,120,689	V1294A	probably damaging	Het
BB019430	A	G	10: 58,704,043		noncoding transcript	Het
Bbs9	T	C	9: 22,578,715	F261L	probably benign	Het
Catsperb	A	T	12: 101,587,985	N646I	possibly damaging	Het
Ccdc112	A	G	18: 46,296,289	I114T	probably damaging	Het
Cecr2	T	C	6: 120,750,916	L340P	probably damaging	Het
Ces2e	T	A	8: 104,927,185	V85E	probably damaging	Het
Cnpy2	C	A	10: 128,326,095	T79K	probably damaging	Het
Cntn4	G	A	6: 106,437,913	R135H	possibly damaging	Het
Cpne8	T	A	15: 90,648,568		probably benign	Het
Ctso	C	T	3: 81,942,381		probably benign	Het
Cyp3a16	C	A	5: 145,452,849	M235I	probably benign	Het
Dll3	A	G	7: 28,296,435	C314R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dqx1	C	A	6: 83,061,012	D460E	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ehbp1	A	G	11: 22,101,164	C438R	probably damaging	Het
Ehd3	T	G	17: 73,805,304	V21G	probably damaging	Het
Ero1lb	G	A	13: 12,604,436	V440I	probably damaging	Het
Fpgt	G	A	3: 155,087,913	A159V	probably damaging	Het
Gcn1l1	T	C	5: 115,576,170	L123P	possibly damaging	Het
Gm14496	A	T	2: 181,997,433	R439W	probably damaging	Het
Gm20767	T	C	13: 120,154,670	V15A	probably damaging	Het
Gm4353	G	C	7: 116,084,413	P49R	probably damaging	Het
Gsdmc2	C	T	15: 63,828,252	A224T	probably benign	Het
Helz	T	A	11: 107,637,734		probably benign	Het
Hnf1a	T	C	5: 114,970,673	T58A	probably benign	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcns1	T	C	2: 164,168,101	Y246C	probably damaging	Het
Kif26b	A	G	1: 178,915,327	E549G	probably benign	Het
Krt9	T	C	11: 100,190,037	I330V	probably benign	Het
Lair1	A	T	7: 4,029,034	S25T	probably benign	Het
Lhx4	T	C	1: 155,705,267	T171A	possibly damaging	Het
Luzp2	A	G	7: 55,167,248	I149V	possibly damaging	Het
Mcoln1	T	A	8: 3,507,422	S143T	probably benign	Het
Mcph1	A	G	8: 18,625,558		probably null	Het
Mgat5	G	A	1: 127,469,249	V578M	probably damaging	Het
Mis18bp1	G	A	12: 65,161,435	T168M	probably benign	Het
Mospd4	G	T	18: 46,465,737		noncoding transcript	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Myom1	T	C	17: 71,072,119	V626A	probably damaging	Het
Nat6	C	T	9: 107,583,619	R238C	probably damaging	Het
Ncam1	T	C	9: 49,507,621		probably benign	Het
Ncor1	AGCTGCTGCTGCTGCTGCTGCTGCTG	AGCTGCTGCTGCTGCTGCTGCTG	11: 62,433,611		probably benign	Het
Ndufv1	T	C	19: 4,012,653		probably null	Het
Nlrp2	A	T	7: 5,298,859	F211L	probably benign	Het
Olfr1368	T	A	13: 21,142,280	Y259F	probably damaging	Het
Olfr1495	T	A	19: 13,768,762	M140K	probably damaging	Het
Olfr517	A	T	7: 108,868,786	F123I	probably damaging	Het
Osbpl11	G	A	16: 33,234,493	V649I	probably benign	Het
Pax8	T	A	2: 24,441,640	M144L	probably benign	Het
Pcnt	T	C	10: 76,369,854	T2555A	probably benign	Het
Plat	T	A	8: 22,768,450	I23K	probably benign	Het
Plpp2	G	A	10: 79,530,929	T51M	probably damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Prl7c1	T	C	13: 27,773,759	M233V	probably benign	Het
Prox1	A	C	1: 190,162,122	F42C	probably damaging	Het
Pwwp2b	A	T	7: 139,256,062	Q473L	possibly damaging	Het
Rims4	A	T	2: 163,865,523	N127K	probably null	Het
Scn1a	T	C	2: 66,328,476	T367A	possibly damaging	Het
Slc23a2	A	G	2: 132,056,880	I579T	possibly damaging	Het
Sp9	T	C	2: 73,273,618	V172A	possibly damaging	Het
Spta1	T	A	1: 174,175,830	L109Q	probably damaging	Het
Strap	ACCTGCCCTCCT	ACCT	6: 137,749,318		probably benign	Het
Synj2	A	T	17: 5,988,068		probably benign	Het
Tgif2-ps2	A	G	17: 40,115,383		noncoding transcript	Het
Tnrc18	A	T	5: 142,765,177	M1216K	unknown	Het
Tpst2	T	A	5: 112,309,821	Y69*	probably null	Het
Tpx2	C	A	2: 152,893,615	A721E	probably benign	Het
Trmt1l	A	G	1: 151,455,004	T591A	probably benign	Het
Tuba8	T	A	6: 121,226,083		probably benign	Het
Ubiad1	T	C	4: 148,444,099	T118A	possibly damaging	Het
Unc13c	T	C	9: 73,517,284	T2017A	probably damaging	Het
Vmn1r59	G	T	7: 5,454,109	N217K	probably benign	Het
Vmn2r87	T	C	10: 130,472,498	I624V	probably damaging	Het
Wdr4	A	G	17: 31,499,155	V315A	probably benign	Het
Xpo7	T	C	14: 70,676,816		probably null	Het
Zfp827	T	A	8: 79,060,774	W190R	probably damaging	Het
Zfp971	A	G	2: 178,033,147	T180A	probably benign	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4133:Dnah7c	UTSW	1	46665990	missense	probably benign	0.01
R4303:Dnah7c	UTSW	1	46748578	missense	probably damaging	1.00
R4329:Dnah7c	UTSW	1	46649281	missense	probably benign	0.33
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4470:Dnah7c	UTSW	1	46748635	missense	possibly damaging	0.56
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6866:Dnah7c	UTSW	1	46657243	missense	probably damaging	1.00
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7131:Dnah7c	UTSW	1	46681772	missense	probably benign	0.00
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8057:Dnah7c	UTSW	1	46688952	missense	possibly damaging	0.52
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CATGTGGGCTCTGTCTCATTGC -3'
(R):5'- CTTACCATAGCTTCTGACAATTGAC -3'

Sequencing Primer
(F):5'- GGGCTCTGTCTCATTGCTTATTGC -3'
(R):5'- CTTCTGACAATTGACTATTGTTAAC -3'

Posted On

2016-10-18