Incidental Mutation 'R0490:Notch4'
ID43464
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Namenotch 4
SynonymsInt3, N4, Int-3
MMRRC Submission 038688-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0490 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34564268-34588503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34582890 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1237 (D1237E)
Ref Sequence ENSEMBL: ENSMUSP00000015612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]
Predicted Effect probably damaging
Transcript: ENSMUST00000015612
AA Change: D1237E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: D1237E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150441
Predicted Effect probably benign
Transcript: ENSMUST00000151654
Predicted Effect probably benign
Transcript: ENSMUST00000151867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156724
Predicted Effect probably benign
Transcript: ENSMUST00000173389
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174707
Meta Mutation Damage Score 0.6428 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,227,342 Y640N probably damaging Het
Adamts9 T A 6: 92,872,866 Q402L probably benign Het
Als2cl A G 9: 110,895,346 T750A probably benign Het
Ank1 C A 8: 23,107,874 probably benign Het
Ap4e1 T A 2: 127,046,186 N404K probably damaging Het
Atf7ip G T 6: 136,609,192 probably benign Het
Bean1 A T 8: 104,215,028 T169S possibly damaging Het
Bod1l G T 5: 41,821,892 T693N probably damaging Het
Ccdc81 A T 7: 89,887,762 V226D probably benign Het
Cd48 A G 1: 171,704,877 *241W probably null Het
Cdon C A 9: 35,452,682 S32Y probably damaging Het
Cers3 A G 7: 66,773,690 S128G possibly damaging Het
Cntn6 T C 6: 104,833,918 V641A possibly damaging Het
Col6a4 G A 9: 106,013,770 T1775I probably damaging Het
Dnah8 T C 17: 30,700,419 V1122A probably benign Het
Dst G T 1: 34,307,368 G5102* probably null Het
Dvl3 C T 16: 20,527,423 probably benign Het
Epha5 G T 5: 84,107,974 probably benign Het
Fscb G A 12: 64,472,887 P602S unknown Het
Fxn A G 19: 24,277,179 probably null Het
Gipc2 A G 3: 152,102,654 L254P possibly damaging Het
Gm973 C T 1: 59,558,234 probably benign Het
Gng8 A G 7: 16,894,983 T14A probably benign Het
Gsdmc3 C T 15: 63,860,250 G309D possibly damaging Het
Gsr T A 8: 33,671,512 probably benign Het
Gtdc1 A T 2: 44,635,040 D152E probably benign Het
Herc1 A G 9: 66,484,999 D4063G probably damaging Het
Hsdl2 C T 4: 59,612,814 probably benign Het
Iqgap3 T C 3: 88,114,056 probably benign Het
Kcnj10 A G 1: 172,369,452 T178A probably damaging Het
Lama5 T A 2: 180,180,169 I2958F possibly damaging Het
Lnx1 T A 5: 74,620,347 probably null Het
Lpl A G 8: 68,896,691 R290G probably damaging Het
Mamdc4 C T 2: 25,563,581 R1196K probably benign Het
Mogat2 T C 7: 99,223,144 S167G probably benign Het
Nek8 T A 11: 78,167,729 I582F probably benign Het
Olfr1373 A G 11: 52,144,666 I288T probably damaging Het
Olfr1457 A G 19: 13,094,812 Y279H probably damaging Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Olfr1499 A G 19: 13,814,855 L245P probably damaging Het
Pcdhb8 T C 18: 37,356,780 S504P probably damaging Het
Pigs T C 11: 78,335,625 S223P probably damaging Het
Prkch A G 12: 73,759,676 I566V probably damaging Het
Ptpn22 T C 3: 103,886,179 S549P probably damaging Het
Rita1 A T 5: 120,611,565 F28I probably damaging Het
Rpgrip1l A T 8: 91,299,845 probably benign Het
Slc1a1 A G 19: 28,897,531 K170E probably benign Het
Spag17 C T 3: 99,982,411 R199W probably damaging Het
Tas2r116 T C 6: 132,856,021 V195A probably benign Het
Trav7d-3 C A 14: 52,744,550 probably benign Het
Trim15 T C 17: 36,866,355 K138E probably benign Het
Ttn T A 2: 76,708,830 H34604L probably benign Het
Ttn C T 2: 76,747,532 R16012K probably damaging Het
Zfp948 T C 17: 21,588,034 V496A probably benign Het
Zfy2 A T Y: 2,106,620 S671R possibly damaging Het
Zswim1 T A 2: 164,825,283 Y152N possibly damaging Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34575561 critical splice donor site probably null
IGL01022:Notch4 APN 17 34565697 missense probably damaging 1.00
IGL01356:Notch4 APN 17 34581026 missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34572588 missense probably damaging 1.00
IGL02150:Notch4 APN 17 34584613 missense probably damaging 1.00
IGL02248:Notch4 APN 17 34587198 missense probably damaging 1.00
IGL02271:Notch4 APN 17 34568471 missense probably damaging 1.00
IGL02299:Notch4 APN 17 34578004 missense probably damaging 1.00
IGL02561:Notch4 APN 17 34568160 splice site probably benign
IGL02604:Notch4 APN 17 34565388 splice site probably null
IGL03323:Notch4 APN 17 34582471 missense probably damaging 1.00
IGL03366:Notch4 APN 17 34572568 missense probably damaging 1.00
IGL03408:Notch4 APN 17 34565568 missense probably benign 0.03
K3955:Notch4 UTSW 17 34568462 missense probably damaging 1.00
R0123:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34581499 splice site probably benign
R0446:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0504:Notch4 UTSW 17 34575091 missense probably damaging 1.00
R0545:Notch4 UTSW 17 34583433 missense probably damaging 1.00
R0702:Notch4 UTSW 17 34575203 missense probably damaging 1.00
R0763:Notch4 UTSW 17 34565332 nonsense probably null
R0854:Notch4 UTSW 17 34568572 missense probably damaging 1.00
R1082:Notch4 UTSW 17 34587390 missense probably damaging 1.00
R1196:Notch4 UTSW 17 34568863 missense probably damaging 1.00
R1316:Notch4 UTSW 17 34567470 missense probably damaging 1.00
R1493:Notch4 UTSW 17 34567682 nonsense probably null
R1527:Notch4 UTSW 17 34565744 missense probably damaging 1.00
R1548:Notch4 UTSW 17 34568422 missense probably damaging 1.00
R1718:Notch4 UTSW 17 34576763 splice site probably benign
R1855:Notch4 UTSW 17 34580962 missense probably benign 0.05
R1988:Notch4 UTSW 17 34587588 missense possibly damaging 0.59
R2022:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2023:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2078:Notch4 UTSW 17 34568715 critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34585950 missense probably benign 0.15
R3846:Notch4 UTSW 17 34578097 missense probably damaging 1.00
R3874:Notch4 UTSW 17 34578069 nonsense probably null
R4087:Notch4 UTSW 17 34584435 missense probably damaging 1.00
R4456:Notch4 UTSW 17 34583833 missense probably damaging 0.99
R4628:Notch4 UTSW 17 34570185 missense probably damaging 1.00
R4728:Notch4 UTSW 17 34570205 missense probably benign 0.00
R4778:Notch4 UTSW 17 34582511 missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34578716 splice site probably benign
R4828:Notch4 UTSW 17 34570060 missense probably damaging 1.00
R4830:Notch4 UTSW 17 34570118 missense probably damaging 1.00
R4859:Notch4 UTSW 17 34587180 missense probably damaging 1.00
R4871:Notch4 UTSW 17 34577562 missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34580920 missense probably damaging 0.99
R5290:Notch4 UTSW 17 34565289 missense probably benign 0.01
R5363:Notch4 UTSW 17 34587123 missense probably damaging 1.00
R5860:Notch4 UTSW 17 34582418 missense probably damaging 1.00
R6352:Notch4 UTSW 17 34567461 missense probably damaging 1.00
R6385:Notch4 UTSW 17 34573814 missense probably null 0.16
R6422:Notch4 UTSW 17 34584559 missense probably benign
R6645:Notch4 UTSW 17 34587816 missense probably benign 0.00
R6836:Notch4 UTSW 17 34586100 missense probably damaging 0.96
R6943:Notch4 UTSW 17 34583603 missense probably benign
R6991:Notch4 UTSW 17 34584800 nonsense probably null
R7078:Notch4 UTSW 17 34582546 missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34572693 missense probably benign 0.05
R7182:Notch4 UTSW 17 34583499 missense probably damaging 1.00
R7240:Notch4 UTSW 17 34576471 missense probably benign 0.00
R7247:Notch4 UTSW 17 34572517 missense probably damaging 1.00
R7556:Notch4 UTSW 17 34575470 missense probably damaging 1.00
R7571:Notch4 UTSW 17 34583574 missense probably damaging 0.99
R7697:Notch4 UTSW 17 34570185 missense probably damaging 1.00
R7763:Notch4 UTSW 17 34582418 missense probably damaging 1.00
R7994:Notch4 UTSW 17 34578090 missense possibly damaging 0.82
R8139:Notch4 UTSW 17 34584800 nonsense probably null
R8171:Notch4 UTSW 17 34582509 nonsense probably null
R8375:Notch4 UTSW 17 34568254 missense possibly damaging 0.90
R8448:Notch4 UTSW 17 34586789 splice site probably null
X0054:Notch4 UTSW 17 34584495 missense probably damaging 1.00
X0067:Notch4 UTSW 17 34586084 nonsense probably null
Z1088:Notch4 UTSW 17 34587915 missense probably damaging 1.00
Z1177:Notch4 UTSW 17 34575148 missense probably damaging 1.00
Z1177:Notch4 UTSW 17 34587908 missense probably damaging 0.97
Z1177:Notch4 UTSW 17 34587909 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTAGAACCCTCTGTGCCATGTTGTC -3'
(R):5'- CACTCCATTCCACTGGGTTGGAAC -3'

Sequencing Primer
(F):5'- TCACTGCCACAATGGAGG -3'
(R):5'- GAACCTAGAGTCTTTTTTAGCATGG -3'
Posted On2013-05-23