Incidental Mutation 'R4902:Polrmt'
ID434642
Institutional Source Beutler Lab
Gene Symbol Polrmt
Ensembl Gene ENSMUSG00000020329
Gene Namepolymerase (RNA) mitochondrial (DNA directed)
Synonyms
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R4902 (G1)
Quality Score42
Status Validated
Chromosome10
Chromosomal Location79736123-79746581 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 79746551 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000124556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020580] [ENSMUST00000159016] [ENSMUST00000162694]
Predicted Effect probably null
Transcript: ENSMUST00000020580
AA Change: M1T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020580
Gene: ENSMUSG00000020329
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 802 1207 5.6e-169 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159016
AA Change: M1T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124936
Gene: ENSMUSG00000020329
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 601 6.27e-50 SMART
low complexity region 629 640 N/A INTRINSIC
Pfam:RNA_pol 727 1133 7.5e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161765
Predicted Effect probably null
Transcript: ENSMUST00000162694
AA Change: M1T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124556
Gene: ENSMUSG00000020329
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 801 895 6.4e-34 PFAM
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of phage and mitochondrial polymerases of lower eukaryotes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die before organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Polrmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Polrmt APN 10 79737597 splice site probably null
IGL01145:Polrmt APN 10 79741137 missense probably benign 0.12
IGL01454:Polrmt APN 10 79743683 missense possibly damaging 0.60
IGL01511:Polrmt APN 10 79740151 missense probably benign 0.00
IGL01750:Polrmt APN 10 79739846 missense possibly damaging 0.84
IGL01766:Polrmt APN 10 79736568 missense possibly damaging 0.71
IGL01827:Polrmt APN 10 79738120 missense probably damaging 1.00
IGL02941:Polrmt APN 10 79737258 splice site probably benign
IGL02982:Polrmt APN 10 79738348 missense probably damaging 1.00
R0323:Polrmt UTSW 10 79741998 missense probably benign 0.41
R0379:Polrmt UTSW 10 79737611 missense possibly damaging 0.89
R0628:Polrmt UTSW 10 79739145 missense possibly damaging 0.89
R1017:Polrmt UTSW 10 79743509 nonsense probably null
R1846:Polrmt UTSW 10 79738209 missense probably damaging 1.00
R2082:Polrmt UTSW 10 79743512 missense probably benign 0.41
R2149:Polrmt UTSW 10 79740275 nonsense probably null
R2359:Polrmt UTSW 10 79736562 missense probably damaging 1.00
R4105:Polrmt UTSW 10 79741733 missense probably benign
R4381:Polrmt UTSW 10 79741808 missense possibly damaging 0.94
R4782:Polrmt UTSW 10 79739523 missense probably benign 0.04
R4904:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4916:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4938:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4963:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4964:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4970:Polrmt UTSW 10 79736587 missense probably damaging 1.00
R5177:Polrmt UTSW 10 79737476 missense probably benign 0.04
R5484:Polrmt UTSW 10 79742054 missense probably damaging 1.00
R5820:Polrmt UTSW 10 79738323 splice site probably null
R5910:Polrmt UTSW 10 79743497 missense probably benign 0.03
R5928:Polrmt UTSW 10 79740352 missense probably damaging 1.00
R6550:Polrmt UTSW 10 79739680 missense probably damaging 1.00
R6979:Polrmt UTSW 10 79746566 utr 5 prime probably null
R7233:Polrmt UTSW 10 79745785 splice site probably null
R7323:Polrmt UTSW 10 79740649 missense probably benign
R7505:Polrmt UTSW 10 79737883 missense probably benign 0.18
R7505:Polrmt UTSW 10 79743176 critical splice donor site probably null
R7777:Polrmt UTSW 10 79739188 missense probably benign 0.03
R7891:Polrmt UTSW 10 79741880 missense probably damaging 1.00
R7952:Polrmt UTSW 10 79741983 splice site probably null
R7974:Polrmt UTSW 10 79741880 missense probably damaging 1.00
X0026:Polrmt UTSW 10 79740740 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTAGAGAGACGTTGCCAACTAG -3'
(R):5'- GAAGAGTATTTCTGCGCATGC -3'

Sequencing Primer
(F):5'- ACTAGTGCCCAGCTAAATGG -3'
(R):5'- GAGTATTTCTGCGCATGCTCTCTTG -3'
Posted On2016-10-18