Incidental Mutation 'R4909:Zfp280d'
ID434648
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Namezinc finger protein 280D
SynonymsSuhw4
MMRRC Submission 042511-MU
Accession Numbers

Ncbi RefSeq: NM_146224.4; MGI:2384583

Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R4909 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72274860-72363777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72331432 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 63 (S63G)
Ref Sequence ENSEMBL: ENSMUSP00000138994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184019] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]
Predicted Effect probably damaging
Transcript: ENSMUST00000098576
AA Change: S677G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535
AA Change: S677G

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183410
AA Change: S677G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535
AA Change: S677G

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183459
Predicted Effect probably benign
Transcript: ENSMUST00000183801
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184019
AA Change: S63G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138994
Gene: ENSMUSG00000038535
AA Change: S63G

DomainStartEndE-ValueType
ZnF_C2H2 42 65 1.23e1 SMART
ZnF_C2H2 88 112 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184025
Predicted Effect probably damaging
Transcript: ENSMUST00000184036
AA Change: S652G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535
AA Change: S652G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184053
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184141
Predicted Effect probably benign
Transcript: ENSMUST00000184399
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184517
AA Change: S677G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535
AA Change: S677G

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Meta Mutation Damage Score 0.1998 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (101/104)
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik A T 12: 20,815,088 noncoding transcript Het
A830010M20Rik C T 5: 107,507,310 Q992* probably null Het
Aars G A 8: 111,055,083 G929D probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Actn4 A T 7: 28,898,657 L506Q probably damaging Het
Adam26a A T 8: 43,570,438 F5Y probably benign Het
Adamts5 G A 16: 85,900,066 Q68* probably null Het
Adcy9 A G 16: 4,298,754 I871T probably benign Het
Ak5 A T 3: 152,655,877 L136H probably damaging Het
Ap1g2 A G 14: 55,105,026 probably null Het
Ap2a1 G A 7: 44,906,381 T355M probably damaging Het
Ap3s2 T C 7: 79,915,241 D60G possibly damaging Het
Apold1 G A 6: 134,983,595 R4Q probably benign Het
Atp13a5 G T 16: 29,334,028 Q207K possibly damaging Het
BC035947 A C 1: 78,498,029 I622S probably damaging Het
Bmper G T 9: 23,377,725 V339F probably benign Het
C1ra A G 6: 124,522,334 D493G probably damaging Het
C3 C T 17: 57,226,830 probably null Het
Cabp4 T A 19: 4,137,121 I209F possibly damaging Het
Cacna1s A T 1: 136,079,604 H453L probably damaging Het
Camk2g A G 14: 20,792,584 V32A probably benign Het
Ccdc175 G A 12: 72,159,753 R240C probably damaging Het
Cdk13 C T 13: 17,772,403 S590N possibly damaging Het
Cfap45 A T 1: 172,529,876 T24S probably benign Het
Clca1 T G 3: 145,024,563 K174Q probably damaging Het
Col1a2 G A 6: 4,529,058 probably benign Het
Colgalt1 A T 8: 71,620,633 I323F possibly damaging Het
Cpeb3 T C 19: 37,174,233 S248G possibly damaging Het
Cpeb3 A T 19: 37,174,659 S106T probably damaging Het
Ctcfl C T 2: 173,095,398 A576T probably benign Het
Cyp4f16 T G 17: 32,550,321 V395G possibly damaging Het
Dchs1 C T 7: 105,766,255 G605S probably damaging Het
Egflam A T 15: 7,219,629 F903I probably damaging Het
Eif5a G A 11: 69,917,485 A62V possibly damaging Het
Fam217a A G 13: 34,910,406 S609P probably damaging Het
Fhad1 T A 4: 141,985,511 I206F probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fras1 T A 5: 96,708,758 M2000K probably benign Het
Frmd5 C T 2: 121,591,653 probably null Het
Gle1 T C 2: 29,936,080 L57P probably benign Het
Glrx3 C A 7: 137,445,036 N52K probably damaging Het
Grin3b A G 10: 79,977,104 *1004W probably null Het
Hectd4 T A 5: 121,263,891 F347L probably benign Het
Htra1 G A 7: 130,985,072 V462I probably benign Het
Itga11 A G 9: 62,755,299 Y518C probably damaging Het
Krtap15 T C 16: 88,829,365 F88L probably benign Het
Ktn1 A T 14: 47,706,460 R866W probably damaging Het
Lamb1 G A 12: 31,288,281 R483H probably damaging Het
Megf6 C T 4: 154,265,391 R983C probably damaging Het
Mybpc3 T A 2: 91,134,812 D1075E probably benign Het
Myo7b A T 18: 31,964,436 N1792K probably benign Het
Nabp2 A T 10: 128,401,687 probably benign Het
Neil3 A G 8: 53,638,893 C7R probably damaging Het
Nxpe2 T A 9: 48,319,597 I491F possibly damaging Het
Obscn A G 11: 59,061,465 V4292A possibly damaging Het
Ogfod3 A G 11: 121,197,492 S139P probably damaging Het
Olfr374 A G 8: 72,109,581 N5S probably damaging Het
Olfr418 A T 1: 173,270,979 D268V probably damaging Het
Olfr682-ps1 C A 7: 105,128,228 V70L probably benign Het
Olfr800 A G 10: 129,660,720 I305V probably benign Het
Oog2 T C 4: 144,195,099 I211T possibly damaging Het
Oosp1 T C 19: 11,688,716 D70G probably benign Het
Padi3 T C 4: 140,795,626 D345G probably damaging Het
Pcyt2 A G 11: 120,615,420 F71L probably benign Het
Pi4k2b T C 5: 52,754,629 probably benign Het
Pigr A C 1: 130,848,458 T577P possibly damaging Het
Pirb G A 7: 3,719,362 Q161* probably null Het
Pnlip A G 19: 58,676,240 E204G possibly damaging Het
Pop7 G T 5: 137,501,899 D57E probably benign Het
Ppfia4 A T 1: 134,332,501 I8N probably damaging Het
Pprc1 A G 19: 46,064,319 T759A probably damaging Het
Prom1 T C 5: 44,045,552 N213S probably benign Het
Prop1 GCTTCACT GCTTCACTTCACT 11: 50,952,036 probably null Het
Prop1 A T 11: 50,952,045 L105H probably damaging Het
Pwp2 A T 10: 78,182,494 M121K possibly damaging Het
Rap1gds1 A T 3: 138,983,748 M161K possibly damaging Het
Rps6kb2 T A 19: 4,157,003 probably benign Het
Rxfp1 A G 3: 79,644,802 S731P probably benign Het
Scfd1 T C 12: 51,390,412 V137A probably benign Het
Slc6a15 G A 10: 103,404,414 D333N probably damaging Het
Sqor T C 2: 122,785,181 V74A possibly damaging Het
Stil T A 4: 115,024,225 Y655* probably null Het
Syt14 A T 1: 192,898,859 I468K probably damaging Het
Tbc1d31 T C 15: 57,962,265 probably null Het
Tspyl5 A T 15: 33,686,849 S317T probably damaging Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttf2 T C 3: 100,954,315 T620A probably damaging Het
Usp32 G A 11: 85,055,772 Q269* probably null Het
Vsig10 T A 5: 117,338,243 V254E probably benign Het
Wdr6 C T 9: 108,572,988 A1114T probably benign Het
Zfp607b A G 7: 27,703,796 D559G probably benign Het
Zfp934 T C 13: 62,517,954 H291R probably damaging Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72322571 missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72312135 missense probably benign 0.19
IGL01333:Zfp280d APN 9 72335114 splice site probably benign
IGL01453:Zfp280d APN 9 72322586 missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72301711 missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72322445 splice site probably benign
IGL02608:Zfp280d APN 9 72307979 missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72312222 missense probably benign 0.33
IGL02676:Zfp280d APN 9 72335074 missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72296025 missense probably benign 0.02
IGL03076:Zfp280d APN 9 72312662 missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0288:Zfp280d UTSW 9 72331339 nonsense probably null
R0419:Zfp280d UTSW 9 72312237 missense probably benign 0.02
R0540:Zfp280d UTSW 9 72307965 missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72361948 missense probably benign
R0722:Zfp280d UTSW 9 72312101 missense possibly damaging 0.63
R1055:Zfp280d UTSW 9 72329167 splice site probably null
R1786:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R1826:Zfp280d UTSW 9 72298780 missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72335080 nonsense probably null
R2130:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72312729 missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72298822 missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72301770 splice site probably benign
R2269:Zfp280d UTSW 9 72301770 splice site probably benign
R2278:Zfp280d UTSW 9 72338773 nonsense probably null
R2850:Zfp280d UTSW 9 72312089 missense probably benign 0.06
R3780:Zfp280d UTSW 9 72322524 missense probably damaging 1.00
R3950:Zfp280d UTSW 9 72296019 missense possibly damaging 0.49
R4330:Zfp280d UTSW 9 72295979 missense possibly damaging 0.86
R4716:Zfp280d UTSW 9 72312665 missense possibly damaging 0.94
R4876:Zfp280d UTSW 9 72298858 splice site probably benign
R5214:Zfp280d UTSW 9 72308113 unclassified probably benign
R5518:Zfp280d UTSW 9 72324135 missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72330942 missense probably benign 0.20
R5945:Zfp280d UTSW 9 72362332 nonsense probably null
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72319257 missense probably damaging 1.00
R7501:Zfp280d UTSW 9 72361942 missense possibly damaging 0.65
R7658:Zfp280d UTSW 9 72324072 missense probably damaging 1.00
R7667:Zfp280d UTSW 9 72301965 missense probably damaging 1.00
R7792:Zfp280d UTSW 9 72331319 missense probably damaging 1.00
R7826:Zfp280d UTSW 9 72312671 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCCTCACTCTGATACATATTCCCAG -3'
(R):5'- CATAAGAATACACCGATTTGCCAG -3'

Sequencing Primer
(F):5'- TTCCCAGTTTAAACTCAAGTATAGC -3'
(R):5'- GTTTGAAAATAACCATTTCAGGGAC -3'
Posted On2016-10-20