Incidental Mutation 'R4835:Mrps5'
ID434651
Institutional Source Beutler Lab
Gene Symbol Mrps5
Ensembl Gene ENSMUSG00000027374
Gene Namemitochondrial ribosomal protein S5
Synonyms
MMRRC Submission 042450-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4835 (G1)
Quality Score37
Status Validated
Chromosome2
Chromosomal Location127587222-127606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127603707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 385 (V385M)
Ref Sequence ENSEMBL: ENSMUSP00000028852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028852
AA Change: V385M

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: V385M

DomainStartEndE-ValueType
low complexity region 108 126 N/A INTRINSIC
Pfam:Ribosomal_S5 220 285 3.5e-20 PFAM
Pfam:Ribosomal_S5_C 297 368 4.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145271
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,574,901 noncoding transcript Het
4933434E20Rik A G 3: 90,063,209 N17D probably benign Het
A1bg T C 15: 60,920,251 D176G probably benign Het
Abcg5 A T 17: 84,658,648 M428K possibly damaging Het
Adam1a A T 5: 121,519,689 C514S probably damaging Het
Angptl3 A G 4: 99,037,412 Q325R probably benign Het
Ankrd26 C T 6: 118,548,850 W378* probably null Het
Apob T C 12: 8,015,391 V4087A possibly damaging Het
Auts2 A G 5: 131,466,093 I117T probably damaging Het
AW146154 T A 7: 41,480,468 E408V probably damaging Het
Bicd1 A T 6: 149,484,090 N107I probably benign Het
Blm T C 7: 80,509,546 S281G probably benign Het
Btaf1 T A 19: 37,002,458 D1542E probably benign Het
C2cd2l A G 9: 44,315,145 probably null Het
Capn8 C A 1: 182,604,551 N362K probably damaging Het
Ccdc14 T G 16: 34,705,038 S186A probably damaging Het
Cdca4 A G 12: 112,821,547 L187P probably damaging Het
Chil6 T A 3: 106,405,974 K20* probably null Het
Cmss1 A T 16: 57,316,182 L109* probably null Het
Cmtm6 G T 9: 114,731,342 W36L probably benign Het
Cnksr3 T G 10: 7,160,757 I35L possibly damaging Het
Col4a2 G T 8: 11,423,570 G534* probably null Het
Col5a1 T G 2: 28,025,644 V180G probably damaging Het
Ctnna3 T C 10: 63,581,944 F154L probably benign Het
Fabp7 G A 10: 57,785,580 V50M possibly damaging Het
Fam170a T A 18: 50,281,983 V232D probably damaging Het
Fam186a T G 15: 99,945,808 T852P unknown Het
Fam20a T C 11: 109,673,563 I455V probably benign Het
Fbxl6 C T 15: 76,536,804 V324M probably damaging Het
Galnt18 T C 7: 111,779,523 T9A probably damaging Het
Golgb1 T A 16: 36,891,407 M191K possibly damaging Het
Gpld1 A G 13: 24,982,716 T650A probably benign Het
Gprc5d A G 6: 135,116,517 F131L probably benign Het
H2afv C T 11: 6,439,437 G7E unknown Het
Haus4 A T 14: 54,545,835 probably null Het
Helq A G 5: 100,774,163 I725T possibly damaging Het
Igsf23 T A 7: 19,941,830 D117V possibly damaging Het
Kiz A T 2: 146,942,088 S514C probably damaging Het
Klhl6 A T 16: 19,957,033 N258K probably benign Het
Krt72 G C 15: 101,781,073 probably null Het
Large1 A T 8: 73,048,347 I245N probably damaging Het
Lrrc31 T C 3: 30,679,157 I469M probably damaging Het
Lypd4 T A 7: 24,866,696 I68F probably benign Het
Mast1 A G 8: 84,923,779 S442P probably damaging Het
Mmp20 T A 9: 7,645,299 H283Q probably benign Het
Ms4a15 T C 19: 10,979,226 K241E possibly damaging Het
Myt1 A G 2: 181,797,462 E259G probably damaging Het
Myt1l C A 12: 29,895,305 T1023K unknown Het
Ncapd3 T C 9: 27,086,046 L1221P probably damaging Het
Ncoa6 A G 2: 155,407,133 V1417A possibly damaging Het
Nmnat1 A G 4: 149,473,345 V80A possibly damaging Het
Nwd2 A G 5: 63,807,846 E1591G probably benign Het
Olfr1057 A G 2: 86,374,509 L301S possibly damaging Het
Olfr455 A G 6: 42,538,836 F62S probably damaging Het
Osbpl1a A T 18: 12,768,536 probably null Het
Papln T C 12: 83,774,420 I204T probably damaging Het
Phf1 A G 17: 26,934,678 T97A probably benign Het
Plxnb1 A G 9: 109,105,374 D890G probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rbp2 G A 9: 98,507,823 C96Y probably damaging Het
Rgmb A T 17: 15,807,362 M365K possibly damaging Het
Ric1 A G 19: 29,595,536 N792S possibly damaging Het
Ruvbl1 T C 6: 88,497,229 Y405H possibly damaging Het
Scaf4 A G 16: 90,250,307 M394T unknown Het
Siglech T A 7: 55,768,429 C48* probably null Het
Skiv2l A G 17: 34,842,921 V695A possibly damaging Het
Slc2a5 A G 4: 150,140,005 T320A probably benign Het
Slc6a7 T C 18: 61,002,205 Y417C probably benign Het
Sox21 A G 14: 118,234,924 C238R possibly damaging Het
Tbata A T 10: 61,183,353 K109N probably damaging Het
Tecpr2 T G 12: 110,954,730 S1246A probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Thada A T 17: 84,441,104 probably null Het
Tpcn2 C T 7: 145,272,351 G204R probably damaging Het
Tpm2 T C 4: 43,519,220 probably null Het
Trbv24 T C 6: 41,218,092 probably benign Het
Tyw1 A G 5: 130,277,058 R341G probably benign Het
Vmn1r183 T G 7: 24,055,139 N122K probably benign Het
Vmn2r61 T A 7: 42,267,035 H357Q possibly damaging Het
Vps13b C T 15: 35,869,372 T2674I probably damaging Het
Vps13b T C 15: 35,910,293 L3401P probably benign Het
Vps16 T G 2: 130,438,300 probably benign Het
Vrtn T A 12: 84,649,694 I406N probably damaging Het
Vwa8 A T 14: 78,934,613 Y278F probably benign Het
Washc4 A T 10: 83,579,512 I789F possibly damaging Het
Zbtb20 C A 16: 43,618,398 T627K probably damaging Het
Zfyve16 A T 13: 92,522,185 I406K probably benign Het
Zfyve9 A C 4: 108,717,998 S629A possibly damaging Het
Zpld1 A T 16: 55,248,255 N164K probably damaging Het
Other mutations in Mrps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Mrps5 APN 2 127591907 missense probably null 0.01
IGL03348:Mrps5 APN 2 127601385 missense probably damaging 0.98
R0369:Mrps5 UTSW 2 127591829 missense probably benign 0.09
R0485:Mrps5 UTSW 2 127591825 missense possibly damaging 0.56
R0622:Mrps5 UTSW 2 127594531 missense probably benign 0.00
R1954:Mrps5 UTSW 2 127596897 splice site probably null
R2182:Mrps5 UTSW 2 127602487 missense probably damaging 1.00
R3414:Mrps5 UTSW 2 127596912 missense probably benign 0.38
R4007:Mrps5 UTSW 2 127591835 missense possibly damaging 0.81
R4687:Mrps5 UTSW 2 127590770 missense probably benign 0.44
R4780:Mrps5 UTSW 2 127598241 missense probably benign 0.00
R4851:Mrps5 UTSW 2 127590745 missense probably benign 0.00
R5076:Mrps5 UTSW 2 127600852 nonsense probably null
R5558:Mrps5 UTSW 2 127602435 missense probably damaging 1.00
R6192:Mrps5 UTSW 2 127601385 missense probably damaging 0.98
R7038:Mrps5 UTSW 2 127600866 missense probably damaging 1.00
R7071:Mrps5 UTSW 2 127600852 nonsense probably null
R7103:Mrps5 UTSW 2 127601410 missense probably damaging 0.99
R7177:Mrps5 UTSW 2 127595697 missense probably benign
R7319:Mrps5 UTSW 2 127595842 missense possibly damaging 0.94
R7387:Mrps5 UTSW 2 127600884 missense probably damaging 1.00
R7460:Mrps5 UTSW 2 127591891 missense not run
R8211:Mrps5 UTSW 2 127603724 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCATCTCAGGGCTCTTG -3'
(R):5'- AAAGTGAGAGTGGCGTGTCC -3'

Sequencing Primer
(F):5'- CATCTCAGGGCTCTTGATGCTG -3'
(R):5'- TGTCAGCACAAGCACTGG -3'
Posted On2016-10-20