Mutagenetix > Incidental Mutations

Incidental Mutation 'R4835:Fbxl6'

434658

Institutional Source

Beutler Lab

Gene Symbol

Fbxl6

Ensembl Gene

ENSMUSG00000022559

Gene Name

F-box and leucine-rich repeat protein 6

Synonyms

MMRRC Submission

042450-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R4835 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

76535721-76538746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76536804 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 324 (V324M)

Ref Sequence

ENSEMBL: ENSMUSP00000023219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023219
AA Change: V324M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: V324M

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
low complexity region	58	77	N/A	INTRINSIC
Pfam:F-box	104	154	3.1e-6	PFAM
Pfam:F-box-like	105	155	1.8e-13	PFAM
low complexity region	163	174	N/A	INTRINSIC
SCOP:d1yrga_	184	448	3e-9	SMART
Blast:LRR	211	236	2e-6	BLAST
Blast:LRR	347	373	6e-8	BLAST
Blast:LRR	375	405	7e-9	BLAST
Blast:LRR	432	456	7e-6	BLAST
Blast:LRR	464	488	1e-5	BLAST
Blast:LRR	489	520	7e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000023220

SMART Domains

Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	32	43	N/A	INTRINSIC
transmembrane domain	46	68	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
transmembrane domain	142	164	N/A	INTRINSIC
transmembrane domain	201	223	N/A	INTRINSIC
Pfam:DUF1011	278	376	3e-38	PFAM
transmembrane domain	409	431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229074

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230513

Predicted Effect

probably benign
Transcript: ENSMUST00000230604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230938

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230994

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	T	7: 29,574,901		noncoding transcript	Het
4933434E20Rik	A	G	3: 90,063,209	N17D	probably benign	Het
A1bg	T	C	15: 60,920,251	D176G	probably benign	Het
Abcg5	A	T	17: 84,658,648	M428K	possibly damaging	Het
Adam1a	A	T	5: 121,519,689	C514S	probably damaging	Het
Angptl3	A	G	4: 99,037,412	Q325R	probably benign	Het
Ankrd26	C	T	6: 118,548,850	W378*	probably null	Het
Apob	T	C	12: 8,015,391	V4087A	possibly damaging	Het
Auts2	A	G	5: 131,466,093	I117T	probably damaging	Het
AW146154	T	A	7: 41,480,468	E408V	probably damaging	Het
Bicd1	A	T	6: 149,484,090	N107I	probably benign	Het
Blm	T	C	7: 80,509,546	S281G	probably benign	Het
Btaf1	T	A	19: 37,002,458	D1542E	probably benign	Het
C2cd2l	A	G	9: 44,315,145		probably null	Het
Capn8	C	A	1: 182,604,551	N362K	probably damaging	Het
Ccdc14	T	G	16: 34,705,038	S186A	probably damaging	Het
Cdca4	A	G	12: 112,821,547	L187P	probably damaging	Het
Chil6	T	A	3: 106,405,974	K20*	probably null	Het
Cmss1	A	T	16: 57,316,182	L109*	probably null	Het
Cmtm6	G	T	9: 114,731,342	W36L	probably benign	Het
Cnksr3	T	G	10: 7,160,757	I35L	possibly damaging	Het
Col4a2	G	T	8: 11,423,570	G534*	probably null	Het
Col5a1	T	G	2: 28,025,644	V180G	probably damaging	Het
Ctnna3	T	C	10: 63,581,944	F154L	probably benign	Het
Fabp7	G	A	10: 57,785,580	V50M	possibly damaging	Het
Fam170a	T	A	18: 50,281,983	V232D	probably damaging	Het
Fam186a	T	G	15: 99,945,808	T852P	unknown	Het
Fam20a	T	C	11: 109,673,563	I455V	probably benign	Het
Galnt18	T	C	7: 111,779,523	T9A	probably damaging	Het
Golgb1	T	A	16: 36,891,407	M191K	possibly damaging	Het
Gpld1	A	G	13: 24,982,716	T650A	probably benign	Het
Gprc5d	A	G	6: 135,116,517	F131L	probably benign	Het
H2afv	C	T	11: 6,439,437	G7E	unknown	Het
Haus4	A	T	14: 54,545,835		probably null	Het
Helq	A	G	5: 100,774,163	I725T	possibly damaging	Het
Igsf23	T	A	7: 19,941,830	D117V	possibly damaging	Het
Kiz	A	T	2: 146,942,088	S514C	probably damaging	Het
Klhl6	A	T	16: 19,957,033	N258K	probably benign	Het
Krt72	G	C	15: 101,781,073		probably null	Het
Large1	A	T	8: 73,048,347	I245N	probably damaging	Het
Lrrc31	T	C	3: 30,679,157	I469M	probably damaging	Het
Lypd4	T	A	7: 24,866,696	I68F	probably benign	Het
Mast1	A	G	8: 84,923,779	S442P	probably damaging	Het
Mmp20	T	A	9: 7,645,299	H283Q	probably benign	Het
Mrps5	G	A	2: 127,603,707	V385M	possibly damaging	Het
Ms4a15	T	C	19: 10,979,226	K241E	possibly damaging	Het
Myt1	A	G	2: 181,797,462	E259G	probably damaging	Het
Myt1l	C	A	12: 29,895,305	T1023K	unknown	Het
Ncapd3	T	C	9: 27,086,046	L1221P	probably damaging	Het
Ncoa6	A	G	2: 155,407,133	V1417A	possibly damaging	Het
Nmnat1	A	G	4: 149,473,345	V80A	possibly damaging	Het
Nwd2	A	G	5: 63,807,846	E1591G	probably benign	Het
Olfr1057	A	G	2: 86,374,509	L301S	possibly damaging	Het
Olfr455	A	G	6: 42,538,836	F62S	probably damaging	Het
Osbpl1a	A	T	18: 12,768,536		probably null	Het
Papln	T	C	12: 83,774,420	I204T	probably damaging	Het
Phf1	A	G	17: 26,934,678	T97A	probably benign	Het
Plxnb1	A	G	9: 109,105,374	D890G	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Rbp2	G	A	9: 98,507,823	C96Y	probably damaging	Het
Rgmb	A	T	17: 15,807,362	M365K	possibly damaging	Het
Ric1	A	G	19: 29,595,536	N792S	possibly damaging	Het
Ruvbl1	T	C	6: 88,497,229	Y405H	possibly damaging	Het
Scaf4	A	G	16: 90,250,307	M394T	unknown	Het
Siglech	T	A	7: 55,768,429	C48*	probably null	Het
Skiv2l	A	G	17: 34,842,921	V695A	possibly damaging	Het
Slc2a5	A	G	4: 150,140,005	T320A	probably benign	Het
Slc6a7	T	C	18: 61,002,205	Y417C	probably benign	Het
Sox21	A	G	14: 118,234,924	C238R	possibly damaging	Het
Tbata	A	T	10: 61,183,353	K109N	probably damaging	Het
Tecpr2	T	G	12: 110,954,730	S1246A	probably benign	Het
Tekt3	A	G	11: 63,081,259	D247G	probably benign	Het
Tenm3	A	T	8: 48,313,236		probably null	Het
Thada	A	T	17: 84,441,104		probably null	Het
Tpcn2	C	T	7: 145,272,351	G204R	probably damaging	Het
Tpm2	T	C	4: 43,519,220		probably null	Het
Trbv24	T	C	6: 41,218,092		probably benign	Het
Tyw1	A	G	5: 130,277,058	R341G	probably benign	Het
Vmn1r183	T	G	7: 24,055,139	N122K	probably benign	Het
Vmn2r61	T	A	7: 42,267,035	H357Q	possibly damaging	Het
Vps13b	C	T	15: 35,869,372	T2674I	probably damaging	Het
Vps13b	T	C	15: 35,910,293	L3401P	probably benign	Het
Vps16	T	G	2: 130,438,300		probably benign	Het
Vrtn	T	A	12: 84,649,694	I406N	probably damaging	Het
Vwa8	A	T	14: 78,934,613	Y278F	probably benign	Het
Washc4	A	T	10: 83,579,512	I789F	possibly damaging	Het
Zbtb20	C	A	16: 43,618,398	T627K	probably damaging	Het
Zfyve16	A	T	13: 92,522,185	I406K	probably benign	Het
Zfyve9	A	C	4: 108,717,998	S629A	possibly damaging	Het
Zpld1	A	T	16: 55,248,255	N164K	probably damaging	Het

Other mutations in Fbxl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Fbxl6	APN	15	76535906	nonsense	probably null
IGL02205:Fbxl6	APN	15	76537341	missense	probably benign	0.05
R0244:Fbxl6	UTSW	15	76537191	missense	probably damaging	1.00
R0449:Fbxl6	UTSW	15	76535955	missense	probably damaging	1.00
R0608:Fbxl6	UTSW	15	76536753	missense	probably benign	0.04
R0904:Fbxl6	UTSW	15	76537083	unclassified	probably null
R1477:Fbxl6	UTSW	15	76537734	missense	probably benign
R1784:Fbxl6	UTSW	15	76538058	missense	probably damaging	1.00
R2109:Fbxl6	UTSW	15	76536973	missense	probably damaging	0.99
R3937:Fbxl6	UTSW	15	76536624	nonsense	probably null
R4414:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4416:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4483:Fbxl6	UTSW	15	76537929	missense	probably damaging	1.00
R6175:Fbxl6	UTSW	15	76538433	missense	probably benign
R6345:Fbxl6	UTSW	15	76535854	missense	probably damaging	1.00
R6750:Fbxl6	UTSW	15	76538412	missense	probably damaging	1.00
R6800:Fbxl6	UTSW	15	76538698	unclassified	probably benign
R7560:Fbxl6	UTSW	15	76538469	missense	probably benign	0.06
R7726:Fbxl6	UTSW	15	76535886
X0058:Fbxl6	UTSW	15	76538476	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- GACCTTGACATGGCAGATGAC -3'
(R):5'- GTCAGCACTGGCATGAACTG -3'

Sequencing Primer
(F):5'- CTTGACATGGCAGATGACACAGAC -3'
(R):5'- GAACTGCAACAACACACCCCTG -3'

Posted On

2016-10-20