Incidental Mutation 'R4895:Tenm3'
ID 434673
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Odz3, Ten-m3, 2610100B16Rik
MMRRC Submission 042499-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R4895 (G1)
Quality Score 190
Status Validated
Chromosome 8
Chromosomal Location 48680717-49296986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48754006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 799 (D799V)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033965
AA Change: D799V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: D799V

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145344
Predicted Effect probably damaging
Transcript: ENSMUST00000190840
AA Change: D790V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: D790V

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Meta Mutation Damage Score 0.4335 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,454,990 (GRCm39) probably benign Het
Abat G A 16: 8,433,826 (GRCm39) A392T probably benign Het
Abca14 G A 7: 119,846,572 (GRCm39) probably null Het
Abcc6 A T 7: 45,630,414 (GRCm39) L1282Q possibly damaging Het
Acss2 A G 2: 155,392,401 (GRCm39) probably benign Het
Adgrf1 G T 17: 43,621,511 (GRCm39) V583L probably benign Het
Aftph T C 11: 20,646,801 (GRCm39) D825G probably damaging Het
Ahnak T C 19: 8,994,805 (GRCm39) V5363A probably benign Het
Apba3 G A 10: 81,107,117 (GRCm39) probably null Het
Asb13 T C 13: 3,693,589 (GRCm39) Y116H probably damaging Het
Asb4 C A 6: 5,398,266 (GRCm39) T77K probably damaging Het
Atp8b4 A T 2: 126,256,289 (GRCm39) H223Q probably benign Het
Best1 A G 19: 9,970,135 (GRCm39) L159P probably benign Het
Cacna1h A T 17: 25,608,396 (GRCm39) M731K probably damaging Het
Catspere1 T A 1: 177,687,427 (GRCm39) noncoding transcript Het
Cenpv A T 11: 62,418,346 (GRCm39) Y202* probably null Het
Cep57 A T 9: 13,727,449 (GRCm39) probably benign Het
Cfap100 T A 6: 90,383,084 (GRCm39) D363V possibly damaging Het
Cluh A G 11: 74,558,231 (GRCm39) Y1126C probably damaging Het
Cyp2j5 A G 4: 96,551,347 (GRCm39) probably null Het
Dnajc11 T C 4: 152,064,390 (GRCm39) F514L probably damaging Het
Efcab3 C T 11: 104,611,112 (GRCm39) T318I probably benign Het
Efcab3 T A 11: 105,008,227 (GRCm39) probably benign Het
Efcab3 A G 11: 104,640,496 (GRCm39) D1026G probably damaging Het
Eif2b4 T G 5: 31,350,298 (GRCm39) Q8P probably benign Het
Epha6 A T 16: 59,486,918 (GRCm39) V1043E probably benign Het
Gm11562 G T 11: 99,511,141 (GRCm39) Q20K unknown Het
Gm14415 A T 2: 176,796,114 (GRCm39) noncoding transcript Het
Gm5431 A G 11: 48,779,855 (GRCm39) S634P probably damaging Het
Gpld1 C A 13: 25,163,711 (GRCm39) N501K probably damaging Het
Gsn C T 2: 35,192,590 (GRCm39) R513C probably damaging Het
Gulp1 T C 1: 44,827,757 (GRCm39) F300L probably benign Het
H2aj T C 6: 136,785,660 (GRCm39) V108A possibly damaging Het
Haus3 T C 5: 34,325,414 (GRCm39) R82G probably benign Het
Herc2 G A 7: 55,872,734 (GRCm39) R4424H probably damaging Het
Hmcn1 T A 1: 150,553,130 (GRCm39) Q2520L probably benign Het
Hs2st1 T C 3: 144,171,014 (GRCm39) I53V probably benign Het
Inpp5e C T 2: 26,287,924 (GRCm39) R624Q probably damaging Het
Ints8 G T 4: 11,230,367 (GRCm39) C491* probably null Het
Itpkb C A 1: 180,241,460 (GRCm39) A710D probably damaging Het
Kcnk4 A C 19: 6,905,784 (GRCm39) probably null Het
Kmt2d T C 15: 98,742,368 (GRCm39) probably benign Het
Lamb3 C T 1: 193,014,622 (GRCm39) R594* probably null Het
Map3k20 A G 2: 72,232,700 (GRCm39) probably benign Het
Maz A T 7: 126,624,472 (GRCm39) probably null Het
Mtr T C 13: 12,231,752 (GRCm39) T651A probably benign Het
Nbeal1 A G 1: 60,332,062 (GRCm39) E2252G probably damaging Het
Ndufa10 A G 1: 92,397,618 (GRCm39) Y61H probably damaging Het
Npat T A 9: 53,481,789 (GRCm39) L1166M probably damaging Het
Or12e1 A C 2: 87,022,192 (GRCm39) I54L probably benign Het
Or4c108 A T 2: 88,804,055 (GRCm39) F60Y probably benign Het
Or5ak20 A T 2: 85,183,341 (GRCm39) *310K probably null Het
Or5b97 C T 19: 12,878,251 (GRCm39) V298M probably damaging Het
Or5h22 C T 16: 58,895,020 (GRCm39) C141Y probably benign Het
Or5p66 A C 7: 107,885,802 (GRCm39) I177S probably damaging Het
Pcdhb3 T C 18: 37,434,759 (GRCm39) F242L probably damaging Het
Phip A G 9: 82,841,648 (GRCm39) V57A probably benign Het
Plekha7 A T 7: 115,788,626 (GRCm39) probably null Het
Pot1a A C 6: 25,753,205 (GRCm39) F444V probably damaging Het
Ppm1a C T 12: 72,831,126 (GRCm39) P217L probably damaging Het
Prepl A G 17: 85,388,494 (GRCm39) F203S probably damaging Het
Prl8a1 T C 13: 27,759,513 (GRCm39) I175V probably benign Het
Ranbp6 A T 19: 29,787,175 (GRCm39) I1059N possibly damaging Het
Rhag A G 17: 41,122,242 (GRCm39) Q59R probably benign Het
Sema4c A C 1: 36,592,651 (GRCm39) probably null Het
Sf3b3 T C 8: 111,542,656 (GRCm39) D902G probably benign Het
Tbc1d23 A G 16: 57,019,220 (GRCm39) probably null Het
Tbrg1 A T 9: 37,566,375 (GRCm39) I54N probably damaging Het
Tchh A T 3: 93,352,993 (GRCm39) E811V unknown Het
Tlr5 T C 1: 182,801,764 (GRCm39) L342P probably damaging Het
Tppp C T 13: 74,178,996 (GRCm39) R146* probably null Het
Trpm4 A T 7: 44,967,482 (GRCm39) M574K probably damaging Het
Uggt1 A T 1: 36,195,345 (GRCm39) F1288Y probably damaging Het
Uggt2 T A 14: 119,256,298 (GRCm39) K1124N probably damaging Het
Usf3 A C 16: 44,041,459 (GRCm39) S1980R possibly damaging Het
Vav2 T C 2: 27,208,973 (GRCm39) D100G probably damaging Het
Vmn2r3 G T 3: 64,167,182 (GRCm39) H650N probably benign Het
Vmn2r59 T A 7: 41,695,218 (GRCm39) Y398F probably damaging Het
Zfp619 A G 7: 39,187,396 (GRCm39) D1142G possibly damaging Het
Zfp933 G A 4: 147,910,892 (GRCm39) R235* probably null Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48,870,095 (GRCm39) missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48,689,060 (GRCm39) missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48,732,077 (GRCm39) missense probably benign 0.39
IGL00720:Tenm3 APN 8 48,729,456 (GRCm39) missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48,870,167 (GRCm39) missense probably benign 0.00
IGL00976:Tenm3 APN 8 48,709,876 (GRCm39) missense probably benign 0.14
IGL01469:Tenm3 APN 8 48,689,458 (GRCm39) missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48,729,680 (GRCm39) missense probably benign 0.09
IGL01590:Tenm3 APN 8 48,681,837 (GRCm39) missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48,707,512 (GRCm39) missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48,689,793 (GRCm39) nonsense probably null
IGL01892:Tenm3 APN 8 48,729,431 (GRCm39) missense probably benign 0.09
IGL02098:Tenm3 APN 8 48,729,611 (GRCm39) missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48,688,511 (GRCm39) missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48,689,729 (GRCm39) missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48,732,233 (GRCm39) splice site probably benign
IGL02502:Tenm3 APN 8 48,741,051 (GRCm39) missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48,752,674 (GRCm39) missense probably benign 0.30
IGL02543:Tenm3 APN 8 48,751,991 (GRCm39) missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48,729,938 (GRCm39) missense probably benign 0.02
IGL03037:Tenm3 APN 8 48,751,913 (GRCm39) missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 49,099,453 (GRCm39) missense probably benign 0.05
IGL03268:Tenm3 APN 8 48,688,558 (GRCm39) missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48,688,381 (GRCm39) missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48,688,642 (GRCm39) missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48,746,692 (GRCm39) missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48,796,380 (GRCm39) missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48,795,694 (GRCm39) missense probably damaging 0.99
R0123:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0134:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48,794,069 (GRCm39) missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48,689,947 (GRCm39) splice site probably benign
R0335:Tenm3 UTSW 8 48,685,140 (GRCm39) missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48,682,010 (GRCm39) missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48,740,826 (GRCm39) missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48,794,195 (GRCm39) splice site probably benign
R0573:Tenm3 UTSW 8 49,127,434 (GRCm39) splice site probably benign
R0599:Tenm3 UTSW 8 48,730,745 (GRCm39) missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48,729,191 (GRCm39) missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48,689,560 (GRCm39) missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48,689,629 (GRCm39) missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48,788,777 (GRCm39) missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48,752,000 (GRCm39) missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48,681,577 (GRCm39) missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48,688,617 (GRCm39) missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48,693,431 (GRCm39) missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48,740,928 (GRCm39) missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48,729,435 (GRCm39) missense probably benign
R1455:Tenm3 UTSW 8 48,732,083 (GRCm39) missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48,689,006 (GRCm39) missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48,763,660 (GRCm39) missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48,796,351 (GRCm39) missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48,740,857 (GRCm39) missense probably benign 0.01
R1522:Tenm3 UTSW 8 48,848,611 (GRCm39) missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48,682,016 (GRCm39) missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48,689,456 (GRCm39) missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48,682,028 (GRCm39) missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48,732,109 (GRCm39) missense probably benign 0.09
R1676:Tenm3 UTSW 8 48,870,154 (GRCm39) missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48,763,669 (GRCm39) missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48,685,139 (GRCm39) missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48,870,214 (GRCm39) missense probably benign 0.05
R1793:Tenm3 UTSW 8 49,127,579 (GRCm39) missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48,729,291 (GRCm39) missense probably benign 0.39
R1863:Tenm3 UTSW 8 48,729,381 (GRCm39) missense probably benign 0.20
R1898:Tenm3 UTSW 8 48,763,796 (GRCm39) missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48,689,348 (GRCm39) missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48,681,626 (GRCm39) missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48,681,703 (GRCm39) missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48,795,291 (GRCm39) critical splice donor site probably null
R2109:Tenm3 UTSW 8 48,796,384 (GRCm39) missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48,870,041 (GRCm39) critical splice donor site probably null
R2190:Tenm3 UTSW 8 48,848,579 (GRCm39) missense probably damaging 1.00
R2204:Tenm3 UTSW 8 49,127,585 (GRCm39) missense probably benign 0.17
R2233:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2234:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2235:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2237:Tenm3 UTSW 8 48,795,372 (GRCm39) missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48,740,988 (GRCm39) missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48,693,305 (GRCm39) missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48,681,590 (GRCm39) missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48,730,781 (GRCm39) missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48,802,258 (GRCm39) missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48,802,439 (GRCm39) missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48,848,693 (GRCm39) missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48,746,761 (GRCm39) missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48,689,005 (GRCm39) missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R4851:Tenm3 UTSW 8 48,763,656 (GRCm39) critical splice donor site probably null
R4867:Tenm3 UTSW 8 48,688,856 (GRCm39) missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48,729,896 (GRCm39) missense probably damaging 0.99
R4962:Tenm3 UTSW 8 48,731,996 (GRCm39) nonsense probably null
R4995:Tenm3 UTSW 8 48,682,172 (GRCm39) missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48,688,861 (GRCm39) missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48,795,343 (GRCm39) missense probably benign 0.14
R5228:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48,682,233 (GRCm39) missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48,689,890 (GRCm39) missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48,740,866 (GRCm39) missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48,689,599 (GRCm39) missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48,820,412 (GRCm39) nonsense probably null
R5566:Tenm3 UTSW 8 48,732,041 (GRCm39) missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48,689,799 (GRCm39) missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48,681,797 (GRCm39) missense probably damaging 1.00
R5931:Tenm3 UTSW 8 49,099,533 (GRCm39) missense probably benign 0.00
R5959:Tenm3 UTSW 8 49,099,482 (GRCm39) nonsense probably null
R5965:Tenm3 UTSW 8 48,681,543 (GRCm39) nonsense probably null
R6062:Tenm3 UTSW 8 48,796,441 (GRCm39) missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48,848,608 (GRCm39) missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48,751,843 (GRCm39) missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48,707,657 (GRCm39) missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48,746,700 (GRCm39) missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48,870,094 (GRCm39) missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48,820,429 (GRCm39) missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48,729,884 (GRCm39) missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48,689,098 (GRCm39) missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6516:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6747:Tenm3 UTSW 8 48,796,278 (GRCm39) missense probably damaging 1.00
R6782:Tenm3 UTSW 8 49,099,291 (GRCm39) critical splice donor site probably null
R6788:Tenm3 UTSW 8 49,127,528 (GRCm39) missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48,709,872 (GRCm39) missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48,729,773 (GRCm39) missense probably benign 0.39
R6913:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R6941:Tenm3 UTSW 8 49,127,451 (GRCm39) missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48,693,514 (GRCm39) nonsense probably null
R6968:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48,693,479 (GRCm39) missense probably damaging 1.00
R7125:Tenm3 UTSW 8 49,127,588 (GRCm39) missense probably benign 0.00
R7140:Tenm3 UTSW 8 48,745,271 (GRCm39) missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48,754,004 (GRCm39) missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48,688,970 (GRCm39) missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48,689,212 (GRCm39) missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48,689,218 (GRCm39) missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48,740,847 (GRCm39) missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48,729,635 (GRCm39) missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48,794,084 (GRCm39) missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48,788,762 (GRCm39) missense probably benign 0.27
R7734:Tenm3 UTSW 8 49,099,368 (GRCm39) missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48,689,500 (GRCm39) missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48,729,335 (GRCm39) missense probably benign 0.01
R7843:Tenm3 UTSW 8 48,682,146 (GRCm39) nonsense probably null
R7951:Tenm3 UTSW 8 48,763,738 (GRCm39) missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48,820,457 (GRCm39) missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48,746,808 (GRCm39) missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48,740,883 (GRCm39) missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48,746,544 (GRCm39) missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48,682,216 (GRCm39) missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48,795,668 (GRCm39) missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48,752,680 (GRCm39) missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48,802,391 (GRCm39) missense probably benign 0.16
R8781:Tenm3 UTSW 8 48,795,484 (GRCm39) frame shift probably null
R8820:Tenm3 UTSW 8 48,763,759 (GRCm39) missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8831:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8853:Tenm3 UTSW 8 48,795,382 (GRCm39) missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48,689,437 (GRCm39) missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48,688,637 (GRCm39) missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48,732,095 (GRCm39) missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48,688,383 (GRCm39) nonsense probably null
R8998:Tenm3 UTSW 8 48,729,722 (GRCm39) missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48,795,688 (GRCm39) missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48,707,668 (GRCm39) missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48,745,186 (GRCm39) missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R9142:Tenm3 UTSW 8 48,788,548 (GRCm39) missense unknown
R9231:Tenm3 UTSW 8 48,689,231 (GRCm39) missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R9310:Tenm3 UTSW 8 49,008,935 (GRCm39) unclassified probably benign
R9336:Tenm3 UTSW 8 48,870,115 (GRCm39) missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48,752,690 (GRCm39) missense probably damaging 1.00
R9393:Tenm3 UTSW 8 49,127,559 (GRCm39) missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48,766,292 (GRCm39) nonsense probably null
R9575:Tenm3 UTSW 8 48,688,796 (GRCm39) missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48,689,246 (GRCm39) missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48,753,849 (GRCm39) missense probably benign 0.00
R9788:Tenm3 UTSW 8 48,788,596 (GRCm39) missense probably benign 0.02
X0010:Tenm3 UTSW 8 48,740,864 (GRCm39) missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48,689,512 (GRCm39) missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48,729,815 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGACTTTCTCCAGGGAG -3'
(R):5'- CAGATTCCAGTACGATGTCTGTATTTC -3'

Sequencing Primer
(F):5'- TGGGTGCTATCCGATCCAATCAG -3'
(R):5'- CCAGTACGATGTCTGTATTTCATTGG -3'
Posted On 2016-10-24