Incidental Mutation 'R4895:Tbc1d23'
ID434674
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene NameTBC1 domain family, member 23
Synonyms4930451A13Rik, D030022P07Rik
MMRRC Submission 042499-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location57168862-57231504 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 57198857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000023431] [ENSMUST00000226586] [ENSMUST00000228172]
Predicted Effect probably null
Transcript: ENSMUST00000023431
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000023431
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000226586
Predicted Effect probably benign
Transcript: ENSMUST00000228172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231435
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 57171776 missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57192675 missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57186685 splice site probably benign
IGL01980:Tbc1d23 APN 16 57189252 splice site probably benign
IGL02457:Tbc1d23 APN 16 57170391 missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57184415 missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57214262 missense probably damaging 1.00
R0386:Tbc1d23 UTSW 16 57189273 missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 57171814 missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R1124:Tbc1d23 UTSW 16 57214162 critical splice donor site probably null
R1430:Tbc1d23 UTSW 16 57214210 missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 57173100 missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57189351 missense probably benign
R4675:Tbc1d23 UTSW 16 57182962 missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57198895 frame shift probably null
R4781:Tbc1d23 UTSW 16 57218415 missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57192628 missense probably benign 0.01
R5389:Tbc1d23 UTSW 16 57198928 missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57198309 missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 57173150 missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57231350 missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57182903 missense probably damaging 0.98
R6232:Tbc1d23 UTSW 16 57170433 missense probably benign 0.39
R6484:Tbc1d23 UTSW 16 57178016 missense probably damaging 1.00
R6670:Tbc1d23 UTSW 16 57214217 missense probably benign 0.00
R6957:Tbc1d23 UTSW 16 57208323 missense probably damaging 1.00
R7218:Tbc1d23 UTSW 16 57170382 missense probably damaging 1.00
R7601:Tbc1d23 UTSW 16 57181534 missense probably benign 0.10
R7877:Tbc1d23 UTSW 16 57173125 missense probably benign 0.35
R7886:Tbc1d23 UTSW 16 57189383 missense possibly damaging 0.95
R8202:Tbc1d23 UTSW 16 57191554 missense probably damaging 1.00
Z1177:Tbc1d23 UTSW 16 57182975 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAACCCGAATGAGCTGAGATC -3'
(R):5'- ACTTCATGTGCTGTCACTGAC -3'

Sequencing Primer
(F):5'- TGAGCTGAGATCAAATGACCTC -3'
(R):5'- CTTCACTAACTTGAAGTGGCAGC -3'
Posted On2016-10-24