Incidental Mutation 'R5534:Coq10b'
ID 434678
Institutional Source Beutler Lab
Gene Symbol Coq10b
Ensembl Gene ENSMUSG00000025981
Gene Name coenzyme Q10B
Synonyms 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
MMRRC Submission 043092-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R5534 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 55091929-55111861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55103359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 46 (Y46H)
Ref Sequence ENSEMBL: ENSMUSP00000084899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027125] [ENSMUST00000087617]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000027125
AA Change: Y96H

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027125
Gene: ENSMUSG00000025981
AA Change: Y96H

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 88 217 2.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000087617
AA Change: Y46H

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084899
Gene: ENSMUSG00000025981
AA Change: Y46H

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 38 167 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190239
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 25,155,530 (GRCm39) D163V probably benign Het
Ank2 A T 3: 126,740,947 (GRCm39) probably benign Het
Ankmy1 T C 1: 92,814,442 (GRCm39) E355G probably damaging Het
Ankmy2 A G 12: 36,232,491 (GRCm39) N172S probably damaging Het
Ankrd50 A G 3: 38,510,231 (GRCm39) M712T probably damaging Het
Apcdd1 T C 18: 63,070,105 (GRCm39) I124T probably benign Het
Carmil3 A G 14: 55,732,347 (GRCm39) K256R probably damaging Het
Cass4 G T 2: 172,268,688 (GRCm39) V259L probably benign Het
Ccdc141 A G 2: 76,888,241 (GRCm39) V508A probably benign Het
Ccdc33 A G 9: 58,024,450 (GRCm39) S226P possibly damaging Het
Cep72 T C 13: 74,210,335 (GRCm39) E9G probably benign Het
Clca4b A T 3: 144,621,227 (GRCm39) Y616N probably damaging Het
Cnot4 A G 6: 35,054,939 (GRCm39) S117P possibly damaging Het
Col11a2 C T 17: 34,269,998 (GRCm39) A429V probably damaging Het
Col4a4 T C 1: 82,465,238 (GRCm39) E979G unknown Het
Cplane1 C A 15: 8,258,319 (GRCm39) F2188L probably benign Het
Dnah17 T C 11: 117,943,596 (GRCm39) T3169A possibly damaging Het
Dock6 G A 9: 21,714,372 (GRCm39) R1824* probably null Het
Dsp A C 13: 38,379,818 (GRCm39) I1589L probably benign Het
Edil3 A G 13: 89,347,593 (GRCm39) T383A probably benign Het
Efemp1 T C 11: 28,817,758 (GRCm39) V79A probably damaging Het
Esyt1 C T 10: 128,355,329 (GRCm39) V471I probably benign Het
Fbxo30 T C 10: 11,165,409 (GRCm39) S44P possibly damaging Het
Fdx2 G T 9: 20,984,562 (GRCm39) D57E probably benign Het
Gbp11 A T 5: 105,478,904 (GRCm39) V178D probably damaging Het
Gna11 A T 10: 81,366,967 (GRCm39) I283N probably damaging Het
Grid2 A T 6: 63,480,345 (GRCm39) Q53L probably benign Het
Jmjd6 A G 11: 116,731,252 (GRCm39) S266P probably damaging Het
Kirrel1 G A 3: 86,997,825 (GRCm39) R233C probably damaging Het
Kmt2d A G 15: 98,735,238 (GRCm39) probably benign Het
Lama3 A T 18: 12,686,267 (GRCm39) T1171S probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Med13 A T 11: 86,210,191 (GRCm39) S650R probably benign Het
Meltf T A 16: 31,709,632 (GRCm39) probably null Het
Mgat1 T C 11: 49,151,976 (GRCm39) V153A probably benign Het
Mmp16 A T 4: 18,110,452 (GRCm39) D416V probably damaging Het
Myh3 A T 11: 66,987,870 (GRCm39) R1448W probably damaging Het
Nedd1 A T 10: 92,530,894 (GRCm39) F398L probably benign Het
Or2a14 A G 6: 43,130,567 (GRCm39) I109M probably benign Het
Or4k45 T C 2: 111,395,349 (GRCm39) T147A probably benign Het
Or5ac17 T C 16: 59,036,403 (GRCm39) D191G probably benign Het
Or5g9 T C 2: 85,552,331 (GRCm39) I194T probably benign Het
Otud3 A G 4: 138,624,894 (GRCm39) L269P probably damaging Het
Otx1 A G 11: 21,946,296 (GRCm39) probably benign Het
Pcdhga7 A C 18: 37,849,331 (GRCm39) D446A probably damaging Het
Pcnx2 T G 8: 126,564,754 (GRCm39) K1046N possibly damaging Het
Pfkp C A 13: 6,698,619 (GRCm39) G33W probably damaging Het
Poglut2 C T 1: 44,151,837 (GRCm39) V351M probably damaging Het
Pold1 A G 7: 44,188,043 (GRCm39) I585T probably damaging Het
Pole4 A G 6: 82,629,115 (GRCm39) Y84H possibly damaging Het
Pramel26 G T 4: 143,539,169 (GRCm39) S108* probably null Het
Ptpn23 A G 9: 110,221,809 (GRCm39) S126P possibly damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rin3 T C 12: 102,353,891 (GRCm39) L766P probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rras2 G A 7: 113,649,650 (GRCm39) T138I possibly damaging Het
Scrn2 A G 11: 96,921,751 (GRCm39) I74V probably benign Het
Sema6d T C 2: 124,501,735 (GRCm39) I526T possibly damaging Het
Shd G T 17: 56,278,577 (GRCm39) E47* probably null Het
Slc22a27 T C 19: 7,903,996 (GRCm39) H47R probably damaging Het
Slc36a3 C G 11: 55,033,595 (GRCm39) W141S possibly damaging Het
Slc9c1 T A 16: 45,376,977 (GRCm39) V429E probably benign Het
Smg8 A T 11: 86,976,296 (GRCm39) D428E probably benign Het
Snrpe A T 1: 133,534,211 (GRCm39) F84Y probably benign Het
Tbc1d2b C T 9: 90,109,559 (GRCm39) D306N possibly damaging Het
Trav9n-4 A G 14: 53,532,356 (GRCm39) Y70C probably damaging Het
Tut7 A G 13: 59,936,367 (GRCm39) F843L probably damaging Het
Ush1c A G 7: 45,870,847 (GRCm39) I330T probably damaging Het
Wnt11 T C 7: 98,488,349 (GRCm39) L12P probably damaging Het
Zan A G 5: 137,436,713 (GRCm39) S2047P unknown Het
Zfp763 A C 17: 33,240,768 (GRCm39) S20R probably damaging Het
Other mutations in Coq10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Coq10b APN 1 55,100,468 (GRCm39) missense probably benign
IGL00697:Coq10b APN 1 55,100,424 (GRCm39) splice site probably null
R1517:Coq10b UTSW 1 55,103,416 (GRCm39) missense probably damaging 1.00
R1751:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R1767:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R2195:Coq10b UTSW 1 55,100,457 (GRCm39) missense probably damaging 1.00
R2421:Coq10b UTSW 1 55,092,136 (GRCm39) missense probably benign 0.00
R4796:Coq10b UTSW 1 55,110,957 (GRCm39) missense probably damaging 1.00
R4851:Coq10b UTSW 1 55,110,903 (GRCm39) missense probably benign 0.13
R5367:Coq10b UTSW 1 55,092,143 (GRCm39) missense probably benign
R5979:Coq10b UTSW 1 55,092,077 (GRCm39) missense probably benign 0.00
R7402:Coq10b UTSW 1 55,100,500 (GRCm39) missense probably benign 0.00
R7836:Coq10b UTSW 1 55,092,013 (GRCm39) start gained probably benign
R7931:Coq10b UTSW 1 55,092,152 (GRCm39) splice site probably benign
R9292:Coq10b UTSW 1 55,110,868 (GRCm39) missense probably damaging 1.00
R9426:Coq10b UTSW 1 55,106,719 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTGAGGTTCCAGTTGTGACC -3'
(R):5'- TCTGTGGGCCAGATGATCTATC -3'

Sequencing Primer
(F):5'- AGTTGTGACCTCTGCCATATATG -3'
(R):5'- TGGTGATCTAGCAGTCTTAAGC -3'
Posted On 2016-10-24