Incidental Mutation 'R5534:Ankrd50'
ID434687
Institutional Source Beutler Lab
Gene Symbol Ankrd50
Ensembl Gene ENSMUSG00000044864
Gene Nameankyrin repeat domain 50
SynonymsE430012K20Rik
MMRRC Submission 043092-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R5534 (G1)
Quality Score169
Status Not validated
Chromosome3
Chromosomal Location38449259-38484844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38456082 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 712 (M712T)
Ref Sequence ENSEMBL: ENSMUSP00000122842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094300] [ENSMUST00000120875] [ENSMUST00000156038]
Predicted Effect probably benign
Transcript: ENSMUST00000094300
SMART Domains Protein: ENSMUSP00000091858
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
ANK 18 47 1.16e-5 SMART
ANK 51 80 3.41e-3 SMART
ANK 84 113 2.9e-6 SMART
ANK 117 147 3.31e-1 SMART
low complexity region 216 243 N/A INTRINSIC
low complexity region 262 282 N/A INTRINSIC
low complexity region 301 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120875
SMART Domains Protein: ENSMUSP00000113349
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
SCOP:d1kaga_ 72 90 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156038
AA Change: M712T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122842
Gene: ENSMUSG00000044864
AA Change: M712T

DomainStartEndE-ValueType
Blast:ANK 440 472 8e-11 BLAST
ANK 507 536 7.95e-4 SMART
ANK 540 569 1.01e-5 SMART
ANK 573 602 6.81e-3 SMART
ANK 606 635 1.7e-3 SMART
ANK 639 668 7.64e-6 SMART
ANK 672 706 4.5e-3 SMART
ANK 710 739 3.33e-6 SMART
ANK 743 772 5.37e-1 SMART
ANK 776 806 1.65e-1 SMART
ANK 809 838 1.2e-3 SMART
ANK 842 871 3.97e-4 SMART
ANK 875 904 3.06e-5 SMART
ANK 908 937 2.88e-1 SMART
ANK 941 970 1.16e-5 SMART
ANK 974 1003 3.41e-3 SMART
ANK 1007 1036 2.9e-6 SMART
ANK 1040 1070 3.31e-1 SMART
low complexity region 1139 1166 N/A INTRINSIC
low complexity region 1185 1205 N/A INTRINSIC
low complexity region 1224 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,228,835 F2188L probably benign Het
Adam18 T A 8: 24,665,514 D163V probably benign Het
Ank2 A T 3: 126,947,298 probably benign Het
Ankmy1 T C 1: 92,886,720 E355G probably damaging Het
Ankmy2 A G 12: 36,182,492 N172S probably damaging Het
Apcdd1 T C 18: 62,937,034 I124T probably benign Het
Carmil3 A G 14: 55,494,890 K256R probably damaging Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Ccdc141 A G 2: 77,057,897 V508A probably benign Het
Ccdc33 A G 9: 58,117,167 S226P possibly damaging Het
Cep72 T C 13: 74,062,216 E9G probably benign Het
Clca4b A T 3: 144,915,466 Y616N probably damaging Het
Cnot4 A G 6: 35,078,004 S117P possibly damaging Het
Col11a2 C T 17: 34,051,024 A429V probably damaging Het
Col4a4 T C 1: 82,487,517 E979G unknown Het
Coq10b T C 1: 55,064,200 Y46H possibly damaging Het
Dnah17 T C 11: 118,052,770 T3169A possibly damaging Het
Dock6 G A 9: 21,803,076 R1824* probably null Het
Dsp A C 13: 38,195,842 I1589L probably benign Het
Edil3 A G 13: 89,199,474 T383A probably benign Het
Efemp1 T C 11: 28,867,758 V79A probably damaging Het
Esyt1 C T 10: 128,519,460 V471I probably benign Het
Fbxo30 T C 10: 11,289,665 S44P possibly damaging Het
Fdx1l G T 9: 21,073,266 D57E probably benign Het
Gbp11 A T 5: 105,331,038 V178D probably damaging Het
Gm13084 G T 4: 143,812,599 S108* probably null Het
Gna11 A T 10: 81,531,133 I283N probably damaging Het
Grid2 A T 6: 63,503,361 Q53L probably benign Het
Jmjd6 A G 11: 116,840,426 S266P probably damaging Het
Kdelc1 C T 1: 44,112,677 V351M probably damaging Het
Kirrel G A 3: 87,090,518 R233C probably damaging Het
Kmt2d A G 15: 98,837,357 probably benign Het
Lama3 A T 18: 12,553,210 T1171S probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med13 A T 11: 86,319,365 S650R probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mgat1 T C 11: 49,261,149 V153A probably benign Het
Mmp16 A T 4: 18,110,452 D416V probably damaging Het
Myh3 A T 11: 67,097,044 R1448W probably damaging Het
Nedd1 A T 10: 92,695,032 F398L probably benign Het
Olfr1009 T C 2: 85,721,987 I194T probably benign Het
Olfr1295 T C 2: 111,565,004 T147A probably benign Het
Olfr199 T C 16: 59,216,040 D191G probably benign Het
Olfr237-ps1 A G 6: 43,153,633 I109M probably benign Het
Otud3 A G 4: 138,897,583 L269P probably damaging Het
Otx1 A G 11: 21,996,296 probably benign Het
Pcdhga7 A C 18: 37,716,278 D446A probably damaging Het
Pcnx2 T G 8: 125,838,015 K1046N possibly damaging Het
Pfkp C A 13: 6,648,583 G33W probably damaging Het
Pold1 A G 7: 44,538,619 I585T probably damaging Het
Pole4 A G 6: 82,652,134 Y84H possibly damaging Het
Ptpn23 A G 9: 110,392,741 S126P possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rin3 T C 12: 102,387,632 L766P probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rras2 G A 7: 114,050,415 T138I possibly damaging Het
Scrn2 A G 11: 97,030,925 I74V probably benign Het
Sema6d T C 2: 124,659,815 I526T possibly damaging Het
Shd G T 17: 55,971,577 E47* probably null Het
Slc22a27 T C 19: 7,926,631 H47R probably damaging Het
Slc36a3 C G 11: 55,142,769 W141S possibly damaging Het
Slc9c1 T A 16: 45,556,614 V429E probably benign Het
Smg8 A T 11: 87,085,470 D428E probably benign Het
Snrpe A T 1: 133,606,473 F84Y probably benign Het
Tbc1d2b C T 9: 90,227,506 D306N possibly damaging Het
Trav9n-4 A G 14: 53,294,899 Y70C probably damaging Het
Ush1c A G 7: 46,221,423 I330T probably damaging Het
Wnt11 T C 7: 98,839,142 L12P probably damaging Het
Zan A G 5: 137,438,451 S2047P unknown Het
Zcchc6 A G 13: 59,788,553 F843L probably damaging Het
Zfp763 A C 17: 33,021,794 S20R probably damaging Het
Other mutations in Ankrd50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ankrd50 APN 3 38452414 utr 3 prime probably benign
PIT4378001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4434001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4651001:Ankrd50 UTSW 3 38455810 nonsense probably null
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0127:Ankrd50 UTSW 3 38456235 missense probably benign 0.00
R0179:Ankrd50 UTSW 3 38455314 missense possibly damaging 0.61
R0417:Ankrd50 UTSW 3 38456361 missense probably damaging 1.00
R0593:Ankrd50 UTSW 3 38483007 nonsense probably null
R1076:Ankrd50 UTSW 3 38454922 missense probably damaging 0.97
R1127:Ankrd50 UTSW 3 38457187 missense probably benign 0.02
R1169:Ankrd50 UTSW 3 38454252 missense probably damaging 1.00
R1212:Ankrd50 UTSW 3 38455687 missense probably damaging 1.00
R1447:Ankrd50 UTSW 3 38455542 missense probably damaging 1.00
R1864:Ankrd50 UTSW 3 38454461 missense probably benign 0.02
R1900:Ankrd50 UTSW 3 38455387 missense probably damaging 1.00
R1907:Ankrd50 UTSW 3 38454052 missense probably damaging 1.00
R1912:Ankrd50 UTSW 3 38456776 missense probably benign 0.07
R2051:Ankrd50 UTSW 3 38454493 missense probably benign 0.21
R2197:Ankrd50 UTSW 3 38455592 missense probably damaging 1.00
R2403:Ankrd50 UTSW 3 38483085 nonsense probably null
R3716:Ankrd50 UTSW 3 38454150 missense probably damaging 0.99
R3944:Ankrd50 UTSW 3 38452496 missense probably benign 0.03
R3948:Ankrd50 UTSW 3 38482841 missense possibly damaging 0.75
R4483:Ankrd50 UTSW 3 38457531 missense probably damaging 1.00
R4577:Ankrd50 UTSW 3 38455941 missense probably damaging 0.98
R4691:Ankrd50 UTSW 3 38483010 missense probably benign 0.01
R4907:Ankrd50 UTSW 3 38454973 nonsense probably null
R4907:Ankrd50 UTSW 3 38456675 missense probably damaging 0.98
R5135:Ankrd50 UTSW 3 38455803 missense probably damaging 1.00
R5356:Ankrd50 UTSW 3 38456185 missense probably damaging 0.99
R5368:Ankrd50 UTSW 3 38455050 missense probably damaging 1.00
R6103:Ankrd50 UTSW 3 38454429 missense probably damaging 0.99
R6169:Ankrd50 UTSW 3 38455839 missense probably damaging 1.00
R6653:Ankrd50 UTSW 3 38457361 missense probably damaging 1.00
R7317:Ankrd50 UTSW 3 38483183 missense possibly damaging 0.90
R7469:Ankrd50 UTSW 3 38454193 missense probably damaging 0.99
R7617:Ankrd50 UTSW 3 38484682 unclassified probably benign
Z1088:Ankrd50 UTSW 3 38457165 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGAACTGTTCTGCCTTCGC -3'
(R):5'- TATATGGGCCACAGAGAGATCG -3'

Sequencing Primer
(F):5'- TGTCGATGCTGTCCACGG -3'
(R):5'- GGCCACAGAGAGATCGTAGAG -3'
Posted On2016-10-24