Incidental Mutation 'R0490:Fxn'
ID43470
Institutional Source Beutler Lab
Gene Symbol Fxn
Ensembl Gene ENSMUSG00000059363
Gene Namefrataxin
SynonymsFrda
MMRRC Submission 038688-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0490 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24261453-24280605 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 24277179 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081333] [ENSMUST00000123684]
Predicted Effect probably null
Transcript: ENSMUST00000081333
SMART Domains Protein: ENSMUSP00000080081
Gene: ENSMUSG00000059363

DomainStartEndE-ValueType
Frataxin_Cyay 87 198 1.61e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123684
SMART Domains Protein: ENSMUSP00000117047
Gene: ENSMUSG00000059363

DomainStartEndE-ValueType
PDB:3T3T|D 79 140 4e-23 PDB
SCOP:d1ekga_ 87 125 2e-12 SMART
Blast:Frataxin_Cyay 87 133 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132688
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit early post-implantation lethality, in the absence of intramitochondrial iron accumulation. Conditional knockouts, specific to striated muscle and neuron/striated muscle, show cardiac hypertrophy and large sensory neuron dysfunction, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,227,342 Y640N probably damaging Het
Adamts9 T A 6: 92,872,866 Q402L probably benign Het
Als2cl A G 9: 110,895,346 T750A probably benign Het
Ank1 C A 8: 23,107,874 probably benign Het
Ap4e1 T A 2: 127,046,186 N404K probably damaging Het
Atf7ip G T 6: 136,609,192 probably benign Het
Bean1 A T 8: 104,215,028 T169S possibly damaging Het
Bod1l G T 5: 41,821,892 T693N probably damaging Het
Ccdc81 A T 7: 89,887,762 V226D probably benign Het
Cd48 A G 1: 171,704,877 *241W probably null Het
Cdon C A 9: 35,452,682 S32Y probably damaging Het
Cers3 A G 7: 66,773,690 S128G possibly damaging Het
Cntn6 T C 6: 104,833,918 V641A possibly damaging Het
Col6a4 G A 9: 106,013,770 T1775I probably damaging Het
Dnah8 T C 17: 30,700,419 V1122A probably benign Het
Dst G T 1: 34,307,368 G5102* probably null Het
Dvl3 C T 16: 20,527,423 probably benign Het
Epha5 G T 5: 84,107,974 probably benign Het
Fscb G A 12: 64,472,887 P602S unknown Het
Gipc2 A G 3: 152,102,654 L254P possibly damaging Het
Gm973 C T 1: 59,558,234 probably benign Het
Gng8 A G 7: 16,894,983 T14A probably benign Het
Gsdmc3 C T 15: 63,860,250 G309D possibly damaging Het
Gsr T A 8: 33,671,512 probably benign Het
Gtdc1 A T 2: 44,635,040 D152E probably benign Het
Herc1 A G 9: 66,484,999 D4063G probably damaging Het
Hsdl2 C T 4: 59,612,814 probably benign Het
Iqgap3 T C 3: 88,114,056 probably benign Het
Kcnj10 A G 1: 172,369,452 T178A probably damaging Het
Lama5 T A 2: 180,180,169 I2958F possibly damaging Het
Lnx1 T A 5: 74,620,347 probably null Het
Lpl A G 8: 68,896,691 R290G probably damaging Het
Mamdc4 C T 2: 25,563,581 R1196K probably benign Het
Mogat2 T C 7: 99,223,144 S167G probably benign Het
Nek8 T A 11: 78,167,729 I582F probably benign Het
Notch4 T A 17: 34,582,890 D1237E probably damaging Het
Olfr1373 A G 11: 52,144,666 I288T probably damaging Het
Olfr1457 A G 19: 13,094,812 Y279H probably damaging Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Olfr1499 A G 19: 13,814,855 L245P probably damaging Het
Pcdhb8 T C 18: 37,356,780 S504P probably damaging Het
Pigs T C 11: 78,335,625 S223P probably damaging Het
Prkch A G 12: 73,759,676 I566V probably damaging Het
Ptpn22 T C 3: 103,886,179 S549P probably damaging Het
Rita1 A T 5: 120,611,565 F28I probably damaging Het
Rpgrip1l A T 8: 91,299,845 probably benign Het
Slc1a1 A G 19: 28,897,531 K170E probably benign Het
Spag17 C T 3: 99,982,411 R199W probably damaging Het
Tas2r116 T C 6: 132,856,021 V195A probably benign Het
Trav7d-3 C A 14: 52,744,550 probably benign Het
Trim15 T C 17: 36,866,355 K138E probably benign Het
Ttn T A 2: 76,708,830 H34604L probably benign Het
Ttn C T 2: 76,747,532 R16012K probably damaging Het
Zfp948 T C 17: 21,588,034 V496A probably benign Het
Zfy2 A T Y: 2,106,620 S671R possibly damaging Het
Zswim1 T A 2: 164,825,283 Y152N possibly damaging Het
Other mutations in Fxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Fxn APN 19 24267350 missense probably damaging 1.00
IGL01066:Fxn APN 19 24267298 splice site probably benign
I2288:Fxn UTSW 19 24262067 splice site probably benign
R1666:Fxn UTSW 19 24262013 missense probably damaging 1.00
R1668:Fxn UTSW 19 24262013 missense probably damaging 1.00
R1817:Fxn UTSW 19 24280401 splice site probably null
R2187:Fxn UTSW 19 24280489 missense probably benign 0.34
R5421:Fxn UTSW 19 24277285 splice site probably null
R6195:Fxn UTSW 19 24262043 missense probably damaging 1.00
R6318:Fxn UTSW 19 24280426 missense probably damaging 0.99
R7418:Fxn UTSW 19 24280496 missense probably benign 0.00
Z1176:Fxn UTSW 19 24262042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAAGCAAACCTTGGGCAGC -3'
(R):5'- TCCCTCAGCACTGTACCTGAGATG -3'

Sequencing Primer
(F):5'- CCTGGAGAACCGTTACATTTG -3'
(R):5'- ACCTGAGATGCTGTAATTGGCTAC -3'
Posted On2013-05-23