Incidental Mutation 'R0490:Slc1a1'
ID43471
Institutional Source Beutler Lab
Gene Symbol Slc1a1
Ensembl Gene ENSMUSG00000024935
Gene Namesolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
SynonymsD130048G10Rik, MEAAC1, EAAC1, EAAT3
MMRRC Submission 038688-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0490 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28835049-28913960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28897531 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 170 (K170E)
Ref Sequence ENSEMBL: ENSMUSP00000025875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025875] [ENSMUST00000175647] [ENSMUST00000179171]
Predicted Effect probably benign
Transcript: ENSMUST00000025875
AA Change: K170E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025875
Gene: ENSMUSG00000024935
AA Change: K170E

DomainStartEndE-ValueType
Pfam:SDF 20 464 2.3e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162189
Predicted Effect probably benign
Transcript: ENSMUST00000175647
SMART Domains Protein: ENSMUSP00000135813
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
Pfam:SPATA6 6 78 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179171
SMART Domains Protein: ENSMUSP00000137486
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Meta Mutation Damage Score 0.1111 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced locomotor activity and excessive excretion of glutamate and aspartate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,227,342 Y640N probably damaging Het
Adamts9 T A 6: 92,872,866 Q402L probably benign Het
Als2cl A G 9: 110,895,346 T750A probably benign Het
Ank1 C A 8: 23,107,874 probably benign Het
Ap4e1 T A 2: 127,046,186 N404K probably damaging Het
Atf7ip G T 6: 136,609,192 probably benign Het
Bean1 A T 8: 104,215,028 T169S possibly damaging Het
Bod1l G T 5: 41,821,892 T693N probably damaging Het
Ccdc81 A T 7: 89,887,762 V226D probably benign Het
Cd48 A G 1: 171,704,877 *241W probably null Het
Cdon C A 9: 35,452,682 S32Y probably damaging Het
Cers3 A G 7: 66,773,690 S128G possibly damaging Het
Cntn6 T C 6: 104,833,918 V641A possibly damaging Het
Col6a4 G A 9: 106,013,770 T1775I probably damaging Het
Dnah8 T C 17: 30,700,419 V1122A probably benign Het
Dst G T 1: 34,307,368 G5102* probably null Het
Dvl3 C T 16: 20,527,423 probably benign Het
Epha5 G T 5: 84,107,974 probably benign Het
Fscb G A 12: 64,472,887 P602S unknown Het
Fxn A G 19: 24,277,179 probably null Het
Gipc2 A G 3: 152,102,654 L254P possibly damaging Het
Gm973 C T 1: 59,558,234 probably benign Het
Gng8 A G 7: 16,894,983 T14A probably benign Het
Gsdmc3 C T 15: 63,860,250 G309D possibly damaging Het
Gsr T A 8: 33,671,512 probably benign Het
Gtdc1 A T 2: 44,635,040 D152E probably benign Het
Herc1 A G 9: 66,484,999 D4063G probably damaging Het
Hsdl2 C T 4: 59,612,814 probably benign Het
Iqgap3 T C 3: 88,114,056 probably benign Het
Kcnj10 A G 1: 172,369,452 T178A probably damaging Het
Lama5 T A 2: 180,180,169 I2958F possibly damaging Het
Lnx1 T A 5: 74,620,347 probably null Het
Lpl A G 8: 68,896,691 R290G probably damaging Het
Mamdc4 C T 2: 25,563,581 R1196K probably benign Het
Mogat2 T C 7: 99,223,144 S167G probably benign Het
Nek8 T A 11: 78,167,729 I582F probably benign Het
Notch4 T A 17: 34,582,890 D1237E probably damaging Het
Olfr1373 A G 11: 52,144,666 I288T probably damaging Het
Olfr1457 A G 19: 13,094,812 Y279H probably damaging Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Olfr1499 A G 19: 13,814,855 L245P probably damaging Het
Pcdhb8 T C 18: 37,356,780 S504P probably damaging Het
Pigs T C 11: 78,335,625 S223P probably damaging Het
Prkch A G 12: 73,759,676 I566V probably damaging Het
Ptpn22 T C 3: 103,886,179 S549P probably damaging Het
Rita1 A T 5: 120,611,565 F28I probably damaging Het
Rpgrip1l A T 8: 91,299,845 probably benign Het
Spag17 C T 3: 99,982,411 R199W probably damaging Het
Tas2r116 T C 6: 132,856,021 V195A probably benign Het
Trav7d-3 C A 14: 52,744,550 probably benign Het
Trim15 T C 17: 36,866,355 K138E probably benign Het
Ttn T A 2: 76,708,830 H34604L probably benign Het
Ttn C T 2: 76,747,532 R16012K probably damaging Het
Zfp948 T C 17: 21,588,034 V496A probably benign Het
Zfy2 A T Y: 2,106,620 S671R possibly damaging Het
Zswim1 T A 2: 164,825,283 Y152N possibly damaging Het
Other mutations in Slc1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Slc1a1 APN 19 28902753 missense possibly damaging 0.66
IGL02726:Slc1a1 APN 19 28911769 missense probably benign 0.04
IGL02865:Slc1a1 APN 19 28905338 missense probably damaging 1.00
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R1219:Slc1a1 UTSW 19 28904746 splice site probably benign
R1333:Slc1a1 UTSW 19 28835211 start gained probably benign
R1623:Slc1a1 UTSW 19 28904722 missense probably benign 0.09
R1669:Slc1a1 UTSW 19 28911794 missense probably benign 0.04
R1746:Slc1a1 UTSW 19 28894469 missense probably benign 0.31
R2516:Slc1a1 UTSW 19 28892912 missense probably benign 0.31
R4198:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4199:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4200:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4432:Slc1a1 UTSW 19 28902709 missense probably benign 0.21
R4744:Slc1a1 UTSW 19 28894525 missense probably benign
R5110:Slc1a1 UTSW 19 28911808 missense probably benign 0.14
R5341:Slc1a1 UTSW 19 28897568 missense probably benign
R6136:Slc1a1 UTSW 19 28905410 missense probably damaging 1.00
R6153:Slc1a1 UTSW 19 28909535 missense probably damaging 0.98
R6640:Slc1a1 UTSW 19 28894570 critical splice donor site probably null
RF020:Slc1a1 UTSW 19 28879155 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCCCTGCCATGAAAGCATGAG -3'
(R):5'- CGTGCATCCTGAAGACTGACCATC -3'

Sequencing Primer
(F):5'- GCATGAGAACGGTCTGGTATTAC -3'
(R):5'- ATCCTGAAGACTGACCATCTTTCTC -3'
Posted On2013-05-23