Incidental Mutation 'R5534:Slc9c1'
ID 434746
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 043092-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R5534 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45376977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 429 (V429E)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: V429E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: V429E

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162151
AA Change: V400E
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 25,155,530 (GRCm39) D163V probably benign Het
Ank2 A T 3: 126,740,947 (GRCm39) probably benign Het
Ankmy1 T C 1: 92,814,442 (GRCm39) E355G probably damaging Het
Ankmy2 A G 12: 36,232,491 (GRCm39) N172S probably damaging Het
Ankrd50 A G 3: 38,510,231 (GRCm39) M712T probably damaging Het
Apcdd1 T C 18: 63,070,105 (GRCm39) I124T probably benign Het
Carmil3 A G 14: 55,732,347 (GRCm39) K256R probably damaging Het
Cass4 G T 2: 172,268,688 (GRCm39) V259L probably benign Het
Ccdc141 A G 2: 76,888,241 (GRCm39) V508A probably benign Het
Ccdc33 A G 9: 58,024,450 (GRCm39) S226P possibly damaging Het
Cep72 T C 13: 74,210,335 (GRCm39) E9G probably benign Het
Clca4b A T 3: 144,621,227 (GRCm39) Y616N probably damaging Het
Cnot4 A G 6: 35,054,939 (GRCm39) S117P possibly damaging Het
Col11a2 C T 17: 34,269,998 (GRCm39) A429V probably damaging Het
Col4a4 T C 1: 82,465,238 (GRCm39) E979G unknown Het
Coq10b T C 1: 55,103,359 (GRCm39) Y46H possibly damaging Het
Cplane1 C A 15: 8,258,319 (GRCm39) F2188L probably benign Het
Dnah17 T C 11: 117,943,596 (GRCm39) T3169A possibly damaging Het
Dock6 G A 9: 21,714,372 (GRCm39) R1824* probably null Het
Dsp A C 13: 38,379,818 (GRCm39) I1589L probably benign Het
Edil3 A G 13: 89,347,593 (GRCm39) T383A probably benign Het
Efemp1 T C 11: 28,817,758 (GRCm39) V79A probably damaging Het
Esyt1 C T 10: 128,355,329 (GRCm39) V471I probably benign Het
Fbxo30 T C 10: 11,165,409 (GRCm39) S44P possibly damaging Het
Fdx2 G T 9: 20,984,562 (GRCm39) D57E probably benign Het
Gbp11 A T 5: 105,478,904 (GRCm39) V178D probably damaging Het
Gna11 A T 10: 81,366,967 (GRCm39) I283N probably damaging Het
Grid2 A T 6: 63,480,345 (GRCm39) Q53L probably benign Het
Jmjd6 A G 11: 116,731,252 (GRCm39) S266P probably damaging Het
Kirrel1 G A 3: 86,997,825 (GRCm39) R233C probably damaging Het
Kmt2d A G 15: 98,735,238 (GRCm39) probably benign Het
Lama3 A T 18: 12,686,267 (GRCm39) T1171S probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Med13 A T 11: 86,210,191 (GRCm39) S650R probably benign Het
Meltf T A 16: 31,709,632 (GRCm39) probably null Het
Mgat1 T C 11: 49,151,976 (GRCm39) V153A probably benign Het
Mmp16 A T 4: 18,110,452 (GRCm39) D416V probably damaging Het
Myh3 A T 11: 66,987,870 (GRCm39) R1448W probably damaging Het
Nedd1 A T 10: 92,530,894 (GRCm39) F398L probably benign Het
Or2a14 A G 6: 43,130,567 (GRCm39) I109M probably benign Het
Or4k45 T C 2: 111,395,349 (GRCm39) T147A probably benign Het
Or5ac17 T C 16: 59,036,403 (GRCm39) D191G probably benign Het
Or5g9 T C 2: 85,552,331 (GRCm39) I194T probably benign Het
Otud3 A G 4: 138,624,894 (GRCm39) L269P probably damaging Het
Otx1 A G 11: 21,946,296 (GRCm39) probably benign Het
Pcdhga7 A C 18: 37,849,331 (GRCm39) D446A probably damaging Het
Pcnx2 T G 8: 126,564,754 (GRCm39) K1046N possibly damaging Het
Pfkp C A 13: 6,698,619 (GRCm39) G33W probably damaging Het
Poglut2 C T 1: 44,151,837 (GRCm39) V351M probably damaging Het
Pold1 A G 7: 44,188,043 (GRCm39) I585T probably damaging Het
Pole4 A G 6: 82,629,115 (GRCm39) Y84H possibly damaging Het
Pramel26 G T 4: 143,539,169 (GRCm39) S108* probably null Het
Ptpn23 A G 9: 110,221,809 (GRCm39) S126P possibly damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rin3 T C 12: 102,353,891 (GRCm39) L766P probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rras2 G A 7: 113,649,650 (GRCm39) T138I possibly damaging Het
Scrn2 A G 11: 96,921,751 (GRCm39) I74V probably benign Het
Sema6d T C 2: 124,501,735 (GRCm39) I526T possibly damaging Het
Shd G T 17: 56,278,577 (GRCm39) E47* probably null Het
Slc22a27 T C 19: 7,903,996 (GRCm39) H47R probably damaging Het
Slc36a3 C G 11: 55,033,595 (GRCm39) W141S possibly damaging Het
Smg8 A T 11: 86,976,296 (GRCm39) D428E probably benign Het
Snrpe A T 1: 133,534,211 (GRCm39) F84Y probably benign Het
Tbc1d2b C T 9: 90,109,559 (GRCm39) D306N possibly damaging Het
Trav9n-4 A G 14: 53,532,356 (GRCm39) Y70C probably damaging Het
Tut7 A G 13: 59,936,367 (GRCm39) F843L probably damaging Het
Ush1c A G 7: 45,870,847 (GRCm39) I330T probably damaging Het
Wnt11 T C 7: 98,488,349 (GRCm39) L12P probably damaging Het
Zan A G 5: 137,436,713 (GRCm39) S2047P unknown Het
Zfp763 A C 17: 33,240,768 (GRCm39) S20R probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGAGTCACCATACCACTTC -3'
(R):5'- CTGCCAGCTTAGACATCTTACC -3'

Sequencing Primer
(F):5'- GAGTCACCATACCACTTCTTTCATG -3'
(R):5'- GACATCTTACCTGTCTTCAGAATG -3'
Posted On 2016-10-24