Incidental Mutation 'R5534:Slc22a27'
ID434755
Institutional Source Beutler Lab
Gene Symbol Slc22a27
Ensembl Gene ENSMUSG00000067656
Gene Namesolute carrier family 22, member 27
SynonymsmOAT6 related protein, AB056442
MMRRC Submission 043092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5534 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7864388-7966027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7926631 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 47 (H47R)
Ref Sequence ENSEMBL: ENSMUSP00000138475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075619] [ENSMUST00000182102]
Predicted Effect probably damaging
Transcript: ENSMUST00000075619
AA Change: H47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093991
Gene: ENSMUSG00000067656
AA Change: H47R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.5e-25 PFAM
Pfam:MFS_1 140 372 1.3e-15 PFAM
Pfam:MFS_1 349 549 8.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182102
AA Change: H47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138475
Gene: ENSMUSG00000067656
AA Change: H47R

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 241 441 1.2e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,228,835 F2188L probably benign Het
Adam18 T A 8: 24,665,514 D163V probably benign Het
Ank2 A T 3: 126,947,298 probably benign Het
Ankmy1 T C 1: 92,886,720 E355G probably damaging Het
Ankmy2 A G 12: 36,182,492 N172S probably damaging Het
Ankrd50 A G 3: 38,456,082 M712T probably damaging Het
Apcdd1 T C 18: 62,937,034 I124T probably benign Het
Carmil3 A G 14: 55,494,890 K256R probably damaging Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Ccdc141 A G 2: 77,057,897 V508A probably benign Het
Ccdc33 A G 9: 58,117,167 S226P possibly damaging Het
Cep72 T C 13: 74,062,216 E9G probably benign Het
Clca4b A T 3: 144,915,466 Y616N probably damaging Het
Cnot4 A G 6: 35,078,004 S117P possibly damaging Het
Col11a2 C T 17: 34,051,024 A429V probably damaging Het
Col4a4 T C 1: 82,487,517 E979G unknown Het
Coq10b T C 1: 55,064,200 Y46H possibly damaging Het
Dnah17 T C 11: 118,052,770 T3169A possibly damaging Het
Dock6 G A 9: 21,803,076 R1824* probably null Het
Dsp A C 13: 38,195,842 I1589L probably benign Het
Edil3 A G 13: 89,199,474 T383A probably benign Het
Efemp1 T C 11: 28,867,758 V79A probably damaging Het
Esyt1 C T 10: 128,519,460 V471I probably benign Het
Fbxo30 T C 10: 11,289,665 S44P possibly damaging Het
Fdx1l G T 9: 21,073,266 D57E probably benign Het
Gbp11 A T 5: 105,331,038 V178D probably damaging Het
Gm13084 G T 4: 143,812,599 S108* probably null Het
Gna11 A T 10: 81,531,133 I283N probably damaging Het
Grid2 A T 6: 63,503,361 Q53L probably benign Het
Jmjd6 A G 11: 116,840,426 S266P probably damaging Het
Kdelc1 C T 1: 44,112,677 V351M probably damaging Het
Kirrel G A 3: 87,090,518 R233C probably damaging Het
Kmt2d A G 15: 98,837,357 probably benign Het
Lama3 A T 18: 12,553,210 T1171S probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med13 A T 11: 86,319,365 S650R probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mgat1 T C 11: 49,261,149 V153A probably benign Het
Mmp16 A T 4: 18,110,452 D416V probably damaging Het
Myh3 A T 11: 67,097,044 R1448W probably damaging Het
Nedd1 A T 10: 92,695,032 F398L probably benign Het
Olfr1009 T C 2: 85,721,987 I194T probably benign Het
Olfr1295 T C 2: 111,565,004 T147A probably benign Het
Olfr199 T C 16: 59,216,040 D191G probably benign Het
Olfr237-ps1 A G 6: 43,153,633 I109M probably benign Het
Otud3 A G 4: 138,897,583 L269P probably damaging Het
Otx1 A G 11: 21,996,296 probably benign Het
Pcdhga7 A C 18: 37,716,278 D446A probably damaging Het
Pcnx2 T G 8: 125,838,015 K1046N possibly damaging Het
Pfkp C A 13: 6,648,583 G33W probably damaging Het
Pold1 A G 7: 44,538,619 I585T probably damaging Het
Pole4 A G 6: 82,652,134 Y84H possibly damaging Het
Ptpn23 A G 9: 110,392,741 S126P possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rin3 T C 12: 102,387,632 L766P probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rras2 G A 7: 114,050,415 T138I possibly damaging Het
Scrn2 A G 11: 97,030,925 I74V probably benign Het
Sema6d T C 2: 124,659,815 I526T possibly damaging Het
Shd G T 17: 55,971,577 E47* probably null Het
Slc36a3 C G 11: 55,142,769 W141S possibly damaging Het
Slc9c1 T A 16: 45,556,614 V429E probably benign Het
Smg8 A T 11: 87,085,470 D428E probably benign Het
Snrpe A T 1: 133,606,473 F84Y probably benign Het
Tbc1d2b C T 9: 90,227,506 D306N possibly damaging Het
Trav9n-4 A G 14: 53,294,899 Y70C probably damaging Het
Ush1c A G 7: 46,221,423 I330T probably damaging Het
Wnt11 T C 7: 98,839,142 L12P probably damaging Het
Zan A G 5: 137,438,451 S2047P unknown Het
Zcchc6 A G 13: 59,788,553 F843L probably damaging Het
Zfp763 A C 17: 33,021,794 S20R probably damaging Het
Other mutations in Slc22a27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Slc22a27 APN 19 7909743 missense possibly damaging 0.93
IGL02516:Slc22a27 APN 19 7864811 missense probably damaging 0.99
IGL02961:Slc22a27 APN 19 7926521 missense probably damaging 0.99
IGL03008:Slc22a27 APN 19 7909702 missense possibly damaging 0.92
PIT4544001:Slc22a27 UTSW 19 7909738 missense probably damaging 1.00
R0172:Slc22a27 UTSW 19 7865836 nonsense probably null
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0280:Slc22a27 UTSW 19 7896822 nonsense probably null
R0561:Slc22a27 UTSW 19 7880162 critical splice donor site probably null
R0597:Slc22a27 UTSW 19 7865884 missense probably benign 0.00
R1005:Slc22a27 UTSW 19 7926751 missense probably damaging 1.00
R1165:Slc22a27 UTSW 19 7909694 splice site probably null
R1217:Slc22a27 UTSW 19 7926668 missense probably benign 0.01
R1533:Slc22a27 UTSW 19 7866983 missense possibly damaging 0.79
R1940:Slc22a27 UTSW 19 7909727 missense probably damaging 1.00
R3714:Slc22a27 UTSW 19 7926450 missense possibly damaging 0.75
R3959:Slc22a27 UTSW 19 7910049 missense probably damaging 1.00
R4059:Slc22a27 UTSW 19 7879608 splice site probably benign
R4249:Slc22a27 UTSW 19 7925879 missense possibly damaging 0.64
R4748:Slc22a27 UTSW 19 7925876 missense probably benign
R5220:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5221:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5232:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5330:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5331:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5345:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5427:Slc22a27 UTSW 19 7879388 critical splice donor site probably null
R5691:Slc22a27 UTSW 19 7926670 missense possibly damaging 0.90
R5828:Slc22a27 UTSW 19 7926402 missense probably damaging 1.00
R5878:Slc22a27 UTSW 19 7926757 missense probably benign 0.01
R5918:Slc22a27 UTSW 19 7910046 missense possibly damaging 0.91
R6185:Slc22a27 UTSW 19 7926588 missense probably benign 0.14
R6901:Slc22a27 UTSW 19 7926579 missense probably damaging 1.00
R7139:Slc22a27 UTSW 19 7926547 missense probably damaging 1.00
R7336:Slc22a27 UTSW 19 7926689 missense probably benign 0.02
R7502:Slc22a27 UTSW 19 7926382 missense probably damaging 1.00
R7556:Slc22a27 UTSW 19 7865754 missense probably damaging 0.98
R7737:Slc22a27 UTSW 19 7896762 missense probably damaging 0.99
R7860:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R8050:Slc22a27 UTSW 19 7880167 missense probably benign 0.18
R8090:Slc22a27 UTSW 19 7865736 splice site probably null
R8150:Slc22a27 UTSW 19 7910025 missense possibly damaging 0.87
RF012:Slc22a27 UTSW 19 7926584 missense probably benign 0.07
Z1177:Slc22a27 UTSW 19 7909730 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACACATTGGAGAAAGTGCC -3'
(R):5'- GGATCAACACTATTTAGGGTGCC -3'

Sequencing Primer
(F):5'- TGCCATTCAAATGAAGAAGATGCC -3'
(R):5'- CACTATTTAGGGTGCCTTTGTGAAAC -3'
Posted On2016-10-24