Incidental Mutation 'R5535:Rdh10'
ID434756
Institutional Source Beutler Lab
Gene Symbol Rdh10
Ensembl Gene ENSMUSG00000025921
Gene Nameretinol dehydrogenase 10 (all-trans)
Synonyms3110069K09Rik, D1Ertd762e, 4921506A21Rik, m366Asp
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location16105774-16133734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16131184 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 294 (Y294H)
Ref Sequence ENSEMBL: ENSMUSP00000027053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027053]
Predicted Effect probably damaging
Transcript: ENSMUST00000027053
AA Change: Y294H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027053
Gene: ENSMUSG00000025921
AA Change: Y294H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:KR 37 231 3.1e-8 PFAM
Pfam:adh_short 90 259 1.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152626
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinol dehydrogenase, which converts all-trans-retinol to all-trans-retinal, with preference for NADP as a cofactor. Studies in mice suggest that this protein is essential for synthesis of embryonic retinoic acid and is required for limb, craniofacial, and organ development. [provided by RefSeq, Dec 2011]
PHENOTYPE: Embryos homozygous for null or hypomorphic alleles exhibit mid-gestational lethality, reduced Retinoic Acid signaling and abnormal limb, craniofacial, somite and cardiac morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Rdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Rdh10 APN 1 16107875 missense probably benign
IGL01646:Rdh10 APN 1 16108022 missense possibly damaging 0.90
IGL01820:Rdh10 APN 1 16128259 missense possibly damaging 0.84
IGL02377:Rdh10 APN 1 16106214 nonsense probably null
IGL03212:Rdh10 APN 1 16107827 missense probably benign 0.03
R0039:Rdh10 UTSW 1 16129284 missense probably damaging 0.97
R0042:Rdh10 UTSW 1 16108036 unclassified probably benign
R0042:Rdh10 UTSW 1 16108036 unclassified probably benign
R0109:Rdh10 UTSW 1 16106265 missense probably damaging 0.97
R0569:Rdh10 UTSW 1 16129293 missense probably damaging 1.00
R1272:Rdh10 UTSW 1 16108016 missense probably damaging 1.00
R1633:Rdh10 UTSW 1 16128196 missense possibly damaging 0.90
R2896:Rdh10 UTSW 1 16106105 splice site probably null
R4623:Rdh10 UTSW 1 16131063 splice site probably benign
R5095:Rdh10 UTSW 1 16131385 missense probably benign 0.01
R5158:Rdh10 UTSW 1 16107997 missense probably damaging 1.00
R6433:Rdh10 UTSW 1 16107855 missense probably damaging 0.98
R6778:Rdh10 UTSW 1 16106184 missense probably damaging 0.99
R6922:Rdh10 UTSW 1 16106031 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCCCTCAGTTGATGTCACAG -3'
(R):5'- CCTGATAGAAACGGCACTCC -3'

Sequencing Primer
(F):5'- CCTCAGTTGATGTCACAGTATTCTGG -3'
(R):5'- ATAAAGGGATACATACACTTGTCCGC -3'
Posted On2016-10-24