Incidental Mutation 'R5535:Hoxd13'
ID434759
Institutional Source Beutler Lab
Gene Symbol Hoxd13
Ensembl Gene ENSMUSG00000001819
Gene Namehomeobox D13
SynonymsHox-4.8, spdh
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74668310-74671599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74668797 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 163 (Y163F)
Ref Sequence ENSEMBL: ENSMUSP00000001872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872]
Predicted Effect probably damaging
Transcript: ENSMUST00000001872
AA Change: Y163F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819
AA Change: Y163F

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit abnormalities of the axial skeleton, especially limbs, and of the male accessory organs, and agenesis of the preputial glands. Mutant males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Hoxd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Hoxd13 APN 2 74670096 missense probably damaging 1.00
R1722:Hoxd13 UTSW 2 74670045 missense probably benign 0.34
R2163:Hoxd13 UTSW 2 74669069 missense possibly damaging 0.82
R4116:Hoxd13 UTSW 2 74668488 missense possibly damaging 0.93
R4400:Hoxd13 UTSW 2 74670015 missense probably damaging 1.00
R4424:Hoxd13 UTSW 2 74669957 nonsense probably null
R4938:Hoxd13 UTSW 2 74668683 missense probably benign 0.26
R7054:Hoxd13 UTSW 2 74669025 missense probably damaging 1.00
R7069:Hoxd13 UTSW 2 74669024 missense probably damaging 1.00
R7677:Hoxd13 UTSW 2 74668565 missense probably benign 0.39
R8329:Hoxd13 UTSW 2 74668317 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCTGTGGCCAAAGAGTGTC -3'
(R):5'- CACAGTACACCTGGCTGTTC -3'

Sequencing Primer
(F):5'- AAAGAGTGTCCCGCGCCAG -3'
(R):5'- TAGCCCTCCATGGAGATGTATGC -3'
Posted On2016-10-24