Incidental Mutation 'R5535:Ckap2l'
ID434762
Institutional Source Beutler Lab
Gene Symbol Ckap2l
Ensembl Gene ENSMUSG00000048327
Gene Namecytoskeleton associated protein 2-like
Synonyms
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location129268210-129297212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129285842 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 139 (C139R)
Ref Sequence ENSEMBL: ENSMUSP00000056145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052708]
Predicted Effect probably benign
Transcript: ENSMUST00000052708
AA Change: C139R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: C139R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:CKAP2_C 425 644 3e-32 PFAM
Pfam:CKAP2_C 675 734 6.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Ckap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Ckap2l APN 2 129269216 missense probably damaging 1.00
IGL02120:Ckap2l APN 2 129285622 missense possibly damaging 0.58
IGL03085:Ckap2l APN 2 129285047 missense probably benign 0.00
IGL03175:Ckap2l APN 2 129285517 missense probably benign 0.01
IGL03333:Ckap2l APN 2 129296308 splice site probably null
R0196:Ckap2l UTSW 2 129285422 missense probably benign 0.43
R0501:Ckap2l UTSW 2 129285491 missense possibly damaging 0.78
R0715:Ckap2l UTSW 2 129285716 missense probably benign 0.02
R0834:Ckap2l UTSW 2 129296304 splice site probably benign
R1119:Ckap2l UTSW 2 129272572 splice site probably benign
R1561:Ckap2l UTSW 2 129270725 missense probably benign 0.01
R1677:Ckap2l UTSW 2 129285167 missense possibly damaging 0.86
R1823:Ckap2l UTSW 2 129275579 missense probably damaging 1.00
R1971:Ckap2l UTSW 2 129285422 missense possibly damaging 0.92
R4803:Ckap2l UTSW 2 129269256 missense probably damaging 1.00
R5214:Ckap2l UTSW 2 129285469 missense probably benign 0.02
R5264:Ckap2l UTSW 2 129285379 missense probably benign 0.01
R5297:Ckap2l UTSW 2 129285370 missense possibly damaging 0.56
R5606:Ckap2l UTSW 2 129286039 missense probably damaging 0.98
R6327:Ckap2l UTSW 2 129285494 missense probably damaging 1.00
R6489:Ckap2l UTSW 2 129269114 missense possibly damaging 0.85
R6726:Ckap2l UTSW 2 129269194 missense probably damaging 1.00
R7199:Ckap2l UTSW 2 129285055 missense probably benign 0.25
R7220:Ckap2l UTSW 2 129275516 missense probably damaging 1.00
R7329:Ckap2l UTSW 2 129285364 missense possibly damaging 0.56
R7374:Ckap2l UTSW 2 129284963 missense probably damaging 1.00
R7383:Ckap2l UTSW 2 129269252 missense possibly damaging 0.88
R7484:Ckap2l UTSW 2 129272535 missense possibly damaging 0.82
R7611:Ckap2l UTSW 2 129285680 missense possibly damaging 0.88
R7868:Ckap2l UTSW 2 129285289 missense probably damaging 1.00
R8338:Ckap2l UTSW 2 129285019 missense probably damaging 0.99
R8514:Ckap2l UTSW 2 129285868 missense possibly damaging 0.61
R8790:Ckap2l UTSW 2 129269252 missense possibly damaging 0.88
RF037:Ckap2l UTSW 2 129270649 small deletion probably benign
Z1176:Ckap2l UTSW 2 129285362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGATCTGGCTTCTCAGG -3'
(R):5'- TATGTTTTCAGACTCCTGGACC -3'

Sequencing Primer
(F):5'- CTTCTCAGGTTTTGGCAGGGC -3'
(R):5'- GATGTTTCCAATCATGTTTTGCCTAG -3'
Posted On2016-10-24