Incidental Mutation 'R5535:Cntfr'
ID434767
Institutional Source Beutler Lab
Gene Symbol Cntfr
Ensembl Gene ENSMUSG00000028444
Gene Nameciliary neurotrophic factor receptor
SynonymsCntfralpha
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41657498-41697089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41663216 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 197 (D197V)
Ref Sequence ENSEMBL: ENSMUSP00000100027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102961] [ENSMUST00000102962]
Predicted Effect probably benign
Transcript: ENSMUST00000102961
AA Change: D197V

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100026
Gene: ENSMUSG00000028444
AA Change: D197V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102962
AA Change: D197V

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100027
Gene: ENSMUSG00000028444
AA Change: D197V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151181
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the ciliary neurotrophic factor (CNTF) receptor that triggers the assembly of a trimolecular complex upon binding to CNTF, and initiate a downstream signaling process. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-linked cell surface protein. Mice lacking the encoded protein die shortly after birth and exhibit a reduction of motoneuron number at birth. The transgenic disruption of this gene specifically in the skeletal muscle followed by a peripheral nerve lesion impairs motor neuron axonal regeneration across the lesion site. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant animals exhibit a significant reduction in the number of motor neurons. Neonatal mutants fail to suckle and die within 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Cntfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1215:Cntfr UTSW 4 41662064 missense probably damaging 1.00
R1635:Cntfr UTSW 4 41658816 missense probably damaging 1.00
R1795:Cntfr UTSW 4 41670841 critical splice donor site probably null
R2115:Cntfr UTSW 4 41663534 splice site probably null
R2437:Cntfr UTSW 4 41671035 missense probably damaging 0.99
R4056:Cntfr UTSW 4 41658900 missense probably damaging 0.99
R4770:Cntfr UTSW 4 41663282 missense possibly damaging 0.57
R5245:Cntfr UTSW 4 41670879 missense possibly damaging 0.92
R5346:Cntfr UTSW 4 41675042 nonsense probably null
R5436:Cntfr UTSW 4 41663322 missense probably damaging 0.98
R6275:Cntfr UTSW 4 41663216 missense possibly damaging 0.89
R6749:Cntfr UTSW 4 41663232 missense possibly damaging 0.47
R7626:Cntfr UTSW 4 41662013 missense possibly damaging 0.89
R9006:Cntfr UTSW 4 41661971 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTGAGCCAAAGAGACAATG -3'
(R):5'- AACAGTACCTGGGCCTCATTC -3'

Sequencing Primer
(F):5'- GTAAAGGATAGCTGCTTATATGGTCC -3'
(R):5'- GGGCCTCATTCCTTTCCAGG -3'
Posted On2016-10-24