Incidental Mutation 'R5535:Immt'
ID434770
Institutional Source Beutler Lab
Gene Symbol Immt
Ensembl Gene ENSMUSG00000052337
Gene Nameinner membrane protein, mitochondrial
Synonymsmitofilin, D830041H16Rik, P87/89, P89, P87, 1700082C19Rik, HMP
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71831331-71877388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71852784 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 158 (P158Q)
Ref Sequence ENSEMBL: ENSMUSP00000128834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064062] [ENSMUST00000101301] [ENSMUST00000114151] [ENSMUST00000165331] [ENSMUST00000166938] [ENSMUST00000166975] [ENSMUST00000171057] [ENSMUST00000207003]
Predicted Effect probably null
Transcript: ENSMUST00000064062
AA Change: P158Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066181
Gene: ENSMUSG00000052337
AA Change: P158Q

DomainStartEndE-ValueType
Pfam:Mitofilin 40 745 5e-207 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101301
AA Change: P147Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098859
Gene: ENSMUSG00000052337
AA Change: P147Q

DomainStartEndE-ValueType
Pfam:Mitofilin 40 734 3.9e-177 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114151
AA Change: P147Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109788
Gene: ENSMUSG00000052337
AA Change: P147Q

DomainStartEndE-ValueType
Pfam:Mitofilin 40 697 1.3e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165331
AA Change: P158Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128834
Gene: ENSMUSG00000052337
AA Change: P158Q

DomainStartEndE-ValueType
Pfam:Mitofilin 40 265 2.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166938
SMART Domains Protein: ENSMUSP00000128967
Gene: ENSMUSG00000052337

DomainStartEndE-ValueType
Pfam:Mitofilin 40 667 3.6e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166975
SMART Domains Protein: ENSMUSP00000128367
Gene: ENSMUSG00000052337

DomainStartEndE-ValueType
Pfam:Mitofilin 40 467 1.1e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167244
Predicted Effect probably null
Transcript: ENSMUST00000171057
AA Change: P146Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133017
Gene: ENSMUSG00000052337
AA Change: P146Q

DomainStartEndE-ValueType
Pfam:Mitofilin 40 188 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207003
AA Change: P147Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Immt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01974:Immt APN 6 71872858 missense probably damaging 0.99
IGL02085:Immt APN 6 71851836 missense probably benign 0.30
IGL02493:Immt APN 6 71844716 splice site probably benign
glut UTSW 6 71861040 missense probably damaging 1.00
P0045:Immt UTSW 6 71868617 missense possibly damaging 0.88
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0565:Immt UTSW 6 71846483 splice site probably benign
R0671:Immt UTSW 6 71871557 missense possibly damaging 0.95
R0676:Immt UTSW 6 71851844 missense probably benign 0.22
R0718:Immt UTSW 6 71863172 missense probably damaging 1.00
R0789:Immt UTSW 6 71861067 missense probably damaging 1.00
R0980:Immt UTSW 6 71874326 missense probably benign 0.19
R1332:Immt UTSW 6 71846272 splice site probably benign
R1688:Immt UTSW 6 71857011 missense probably damaging 1.00
R2106:Immt UTSW 6 71871515 missense possibly damaging 0.80
R2149:Immt UTSW 6 71844675 nonsense probably null
R3706:Immt UTSW 6 71862362 missense probably benign 0.01
R4393:Immt UTSW 6 71872800 missense probably benign 0.04
R4543:Immt UTSW 6 71851778 missense probably damaging 0.97
R4645:Immt UTSW 6 71856939 missense probably damaging 1.00
R4774:Immt UTSW 6 71852736 missense probably damaging 1.00
R5920:Immt UTSW 6 71863196 missense probably benign 0.18
R7002:Immt UTSW 6 71861040 missense probably damaging 1.00
R7266:Immt UTSW 6 71874705 missense probably benign 0.26
R7326:Immt UTSW 6 71846369 missense probably damaging 1.00
R7949:Immt UTSW 6 71874343 nonsense probably null
R8185:Immt UTSW 6 71872851 nonsense probably null
R8200:Immt UTSW 6 71871437 missense probably damaging 0.96
R8444:Immt UTSW 6 71871508 nonsense probably null
R8828:Immt UTSW 6 71852778 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGGAGAAGACTTTGTGTC -3'
(R):5'- CCTAGGCAAGTTTGAAGGCTGG -3'

Sequencing Primer
(F):5'- GTTTCTGTTTATTAAACACAGGGCAG -3'
(R):5'- TGGAAACAGTCTAGGTATGTATTTCC -3'
Posted On2016-10-24