Incidental Mutation 'R5535:Mfhas1'
ID434773
Institutional Source Beutler Lab
Gene Symbol Mfhas1
Ensembl Gene ENSMUSG00000070056
Gene Namemalignant fibrous histiocytoma amplified sequence 1
Synonyms2310066G09Rik, D8Ertd91e
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location35587798-35679449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35590269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 633 (R633S)
Ref Sequence ENSEMBL: ENSMUSP00000044135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037666
AA Change: R633S

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: R633S

DomainStartEndE-ValueType
LRR 58 81 1.97e1 SMART
LRR 82 105 5.72e-1 SMART
LRR 106 125 2.79e1 SMART
LRR 130 152 8.09e-1 SMART
LRR_TYP 153 175 7.78e-3 SMART
LRR 176 195 5.48e0 SMART
LRR 199 221 6.57e-1 SMART
LRR 222 244 3.98e1 SMART
LRR 245 267 1.25e-1 SMART
LRR 268 290 3.27e1 SMART
LRR 291 313 1.43e-1 SMART
LRR 314 334 1.12e1 SMART
LRR_TYP 337 360 4.11e-2 SMART
Pfam:Roc 407 537 6.9e-11 PFAM
low complexity region 743 750 N/A INTRINSIC
low complexity region 754 761 N/A INTRINSIC
low complexity region 808 820 N/A INTRINSIC
Blast:LY 1018 1038 7e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181322
Predicted Effect unknown
Transcript: ENSMUST00000209953
AA Change: R438S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Mfhas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Mfhas1 APN 8 35590771 missense probably benign 0.00
IGL00841:Mfhas1 APN 8 35590886 missense probably damaging 0.97
IGL01548:Mfhas1 APN 8 35590459 missense probably damaging 1.00
IGL02031:Mfhas1 APN 8 35589372 missense probably damaging 0.99
IGL02093:Mfhas1 APN 8 35589344 missense probably damaging 1.00
IGL02314:Mfhas1 APN 8 35588773 missense probably damaging 0.98
IGL02412:Mfhas1 APN 8 35588815 missense probably benign 0.11
IGL02638:Mfhas1 APN 8 35590950 missense possibly damaging 0.55
IGL02663:Mfhas1 APN 8 35589906 missense probably damaging 0.99
R0545:Mfhas1 UTSW 8 35589048 missense probably damaging 1.00
R0619:Mfhas1 UTSW 8 35590675 missense probably benign 0.00
R0637:Mfhas1 UTSW 8 35590026 nonsense probably null
R1251:Mfhas1 UTSW 8 35591053 missense probably damaging 0.97
R1829:Mfhas1 UTSW 8 35590068 missense probably benign
R1829:Mfhas1 UTSW 8 35590248 missense probably benign 0.09
R1839:Mfhas1 UTSW 8 35590858 missense possibly damaging 0.95
R1934:Mfhas1 UTSW 8 35591097 missense possibly damaging 0.52
R1937:Mfhas1 UTSW 8 35589645 missense probably damaging 0.99
R2038:Mfhas1 UTSW 8 35591277 missense probably damaging 1.00
R2982:Mfhas1 UTSW 8 35591115 missense probably benign 0.07
R4566:Mfhas1 UTSW 8 35591049 missense probably damaging 1.00
R4604:Mfhas1 UTSW 8 35588610 missense probably benign 0.00
R4693:Mfhas1 UTSW 8 35589175 missense probably damaging 1.00
R5205:Mfhas1 UTSW 8 35591007 missense probably benign 0.10
R5631:Mfhas1 UTSW 8 35588419 missense probably damaging 0.96
R5744:Mfhas1 UTSW 8 35589482 missense probably damaging 1.00
R6580:Mfhas1 UTSW 8 35589265 missense probably damaging 1.00
R6663:Mfhas1 UTSW 8 35589118 missense probably damaging 1.00
R6998:Mfhas1 UTSW 8 35591356 missense probably damaging 1.00
R7046:Mfhas1 UTSW 8 35664790 missense probably benign 0.00
R7054:Mfhas1 UTSW 8 35588638 missense probably benign 0.30
R7171:Mfhas1 UTSW 8 35588992 missense probably benign 0.08
R7396:Mfhas1 UTSW 8 35590199 missense probably damaging 0.97
R7557:Mfhas1 UTSW 8 35589604 missense possibly damaging 0.50
R7853:Mfhas1 UTSW 8 35589871 nonsense probably null
R7876:Mfhas1 UTSW 8 35589543 missense probably damaging 1.00
R8815:Mfhas1 UTSW 8 35590240 missense probably damaging 0.99
X0060:Mfhas1 UTSW 8 35588404 missense possibly damaging 0.52
Z1088:Mfhas1 UTSW 8 35590236 missense probably benign 0.04
Z1177:Mfhas1 UTSW 8 35590385 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATCTAGCCAAGGTGGTGGATG -3'
(R):5'- TAGGAAAGAGCACTCTGGAGCC -3'

Sequencing Primer
(F):5'- CAAGGTGGTGGATGAGGCCC -3'
(R):5'- TCAGTCAGACCTGCCTGCAG -3'
Posted On2016-10-24