Incidental Mutation 'R5535:Olfr907'
ID434776
Institutional Source Beutler Lab
Gene Symbol Olfr907
Ensembl Gene ENSMUSG00000094810
Gene Nameolfactory receptor 907
SynonymsMOR165-5, GA_x6K02T2PVTD-32204729-32205661
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38495801-38499882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38498998 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 110 (S110T)
Ref Sequence ENSEMBL: ENSMUSP00000148894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052901] [ENSMUST00000214003] [ENSMUST00000214264]
Predicted Effect probably benign
Transcript: ENSMUST00000052901
AA Change: S110T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051531
Gene: ENSMUSG00000094810
AA Change: S110T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-46 PFAM
Pfam:7tm_1 41 290 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214003
AA Change: S110T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214264
AA Change: S110T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Olfr907
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Olfr907 APN 9 38498875 missense probably benign 0.04
IGL01960:Olfr907 APN 9 38498707 missense probably damaging 1.00
IGL02612:Olfr907 APN 9 38499473 missense probably benign 0.01
R0366:Olfr907 UTSW 9 38499154 missense possibly damaging 0.94
R0400:Olfr907 UTSW 9 38498911 missense possibly damaging 0.63
R0726:Olfr907 UTSW 9 38499122 missense possibly damaging 0.72
R1511:Olfr907 UTSW 9 38498818 missense probably benign
R1663:Olfr907 UTSW 9 38499572 missense unknown
R1763:Olfr907 UTSW 9 38499038 missense probably damaging 1.00
R4810:Olfr907 UTSW 9 38499324 nonsense probably null
R4851:Olfr907 UTSW 9 38499023 missense probably damaging 1.00
R4945:Olfr907 UTSW 9 38499289 missense probably damaging 1.00
R5576:Olfr907 UTSW 9 38498908 missense probably damaging 1.00
R5618:Olfr907 UTSW 9 38498740 nonsense probably null
R5829:Olfr907 UTSW 9 38499249 nonsense probably null
R6249:Olfr907 UTSW 9 38499584 missense unknown
R6353:Olfr907 UTSW 9 38498816 missense probably benign 0.30
R6580:Olfr907 UTSW 9 38499023 missense probably damaging 1.00
R6611:Olfr907 UTSW 9 38499238 missense probably damaging 1.00
R6997:Olfr907 UTSW 9 38499311 missense possibly damaging 0.94
R7407:Olfr907 UTSW 9 38499504 nonsense probably null
R7420:Olfr907 UTSW 9 38499063 missense probably benign 0.11
R7567:Olfr907 UTSW 9 38499073 missense probably benign 0.00
R8382:Olfr907 UTSW 9 38499292 missense probably damaging 0.98
X0028:Olfr907 UTSW 9 38499090 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACGTGATAGCTACATTGGGG -3'
(R):5'- TACTGGTGCAGGAGATCTGG -3'

Sequencing Primer
(F):5'- GATAGCTACATTGGGGAATTTAGC -3'
(R):5'- TCACAGAATGTCAGTCTTAGGATAC -3'
Posted On2016-10-24