Incidental Mutation 'R0179:Amotl1'
ID43478
Institutional Source Beutler Lab
Gene Symbol Amotl1
Ensembl Gene ENSMUSG00000013076
Gene Nameangiomotin-like 1
SynonymsJEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0179 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14541966-14645056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14548773 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 890 (A890V)
Ref Sequence ENSEMBL: ENSMUSP00000152834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000223132]
Predicted Effect probably benign
Transcript: ENSMUST00000013220
AA Change: A853V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076
AA Change: A853V

DomainStartEndE-ValueType
low complexity region 203 224 N/A INTRINSIC
low complexity region 418 441 N/A INTRINSIC
coiled coil region 449 472 N/A INTRINSIC
Blast:PAC 491 532 1e-10 BLAST
low complexity region 562 575 N/A INTRINSIC
Pfam:Angiomotin_C 616 822 4.4e-96 PFAM
low complexity region 853 878 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160770
SMART Domains Protein: ENSMUSP00000124281
Gene: ENSMUSG00000013076

DomainStartEndE-ValueType
low complexity region 117 138 N/A INTRINSIC
low complexity region 332 355 N/A INTRINSIC
coiled coil region 363 386 N/A INTRINSIC
Blast:PAC 405 446 1e-10 BLAST
low complexity region 476 489 N/A INTRINSIC
Pfam:Angiomotin_C 530 738 5.2e-95 PFAM
low complexity region 767 792 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223132
AA Change: A890V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Amotl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Amotl1 APN 9 14571715 splice site probably benign
IGL02750:Amotl1 APN 9 14548791 missense probably benign 0.34
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0178:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0853:Amotl1 UTSW 9 14592778 missense probably damaging 0.99
R0941:Amotl1 UTSW 9 14596558 missense possibly damaging 0.90
R1447:Amotl1 UTSW 9 14555742 missense probably benign
R1689:Amotl1 UTSW 9 14593222 missense probably damaging 0.99
R1692:Amotl1 UTSW 9 14551722 missense possibly damaging 0.94
R1858:Amotl1 UTSW 9 14575401 missense probably benign 0.34
R2158:Amotl1 UTSW 9 14575169 missense probably benign 0.00
R2184:Amotl1 UTSW 9 14575390 missense probably benign 0.00
R3040:Amotl1 UTSW 9 14572773 missense probably benign 0.42
R4226:Amotl1 UTSW 9 14593678 missense probably benign 0.00
R4776:Amotl1 UTSW 9 14593373 nonsense probably null
R4854:Amotl1 UTSW 9 14593451 nonsense probably null
R5283:Amotl1 UTSW 9 14558484 missense probably damaging 1.00
R5478:Amotl1 UTSW 9 14592752 critical splice donor site probably null
R5562:Amotl1 UTSW 9 14575297 missense possibly damaging 0.56
R5970:Amotl1 UTSW 9 14596528 missense probably damaging 1.00
R6265:Amotl1 UTSW 9 14571655 missense possibly damaging 0.93
R6974:Amotl1 UTSW 9 14644920 nonsense probably null
R7016:Amotl1 UTSW 9 14593699 missense probably damaging 0.99
R7058:Amotl1 UTSW 9 14575236 missense possibly damaging 0.94
R7317:Amotl1 UTSW 9 14575219 missense probably benign 0.02
R7730:Amotl1 UTSW 9 14555763 missense possibly damaging 0.53
R7996:Amotl1 UTSW 9 14593705 missense possibly damaging 0.94
R8077:Amotl1 UTSW 9 14550502 missense probably damaging 1.00
R8116:Amotl1 UTSW 9 14555572 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACATGGTCTGACGTGGCTTC -3'
(R):5'- CCACTGGTCCAACGTGGTTTTCTG -3'

Sequencing Primer
(F):5'- GTCTGACGTGGCTTCCTGAC -3'
(R):5'- TATATGGAACTGGGCACATGATAC -3'
Posted On2013-05-24