Incidental Mutation 'R5535:Helz'
ID434784
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107646120 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 947 (D947G)
Ref Sequence ENSEMBL: ENSMUSP00000102357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: D948G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: D948G

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: D947G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: D947G

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: D947G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: D947G

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133862
AA Change: D266G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721
AA Change: D266G

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143634
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R8024:Helz UTSW 11 107686421 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- CCACTCCGACTTGTAGATTGG -3'
(R):5'- AGAACTTGTATCACTGCCAGCTC -3'

Sequencing Primer
(F):5'- GACTTGTAGATTGGTTTTTAAAAGGC -3'
(R):5'- TGAGCACCCTTTCCACAT -3'
Posted On2016-10-24