Mutagenetix > Incidental Mutation

Incidental Mutation 'R5535:Hectd1'

434787

Institutional Source

Beutler Lab

Gene Symbol

Hectd1

Ensembl Gene

ENSMUSG00000035247

Gene Name

HECT domain E3 ubiquitin protein ligase 1

Synonyms

b2b327Clo, opm, A630086P08Rik

MMRRC Submission

043093-MU

Accession Numbers

Genbank: NM_144788; MGI: 2384768

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5535 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51743722-51829536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51802326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 332 (F332I)

Ref Sequence

ENSEMBL: ENSMUSP00000046766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]

AlphaFold

Q69ZR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000042052
AA Change: F332I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: F332I

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	395	424	1.44e-1	SMART
ANK	426	455	2.81e-4	SMART
ANK	459	488	1.55e2	SMART
low complexity region	490	509	N/A	INTRINSIC
low complexity region	630	654	N/A	INTRINSIC
low complexity region	707	723	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
Pfam:Sad1_UNC	1107	1240	9.2e-27	PFAM
low complexity region	1259	1271	N/A	INTRINSIC
Pfam:MIB_HERC2	1277	1338	7.6e-27	PFAM
low complexity region	1373	1401	N/A	INTRINSIC
low complexity region	1441	1458	N/A	INTRINSIC
low complexity region	1484	1495	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1600	1630	N/A	INTRINSIC
low complexity region	1633	1651	N/A	INTRINSIC
low complexity region	1674	1703	N/A	INTRINSIC
low complexity region	1745	1752	N/A	INTRINSIC
PDB:2LC3\|A	1879	1966	4e-57	PDB
low complexity region	2101	2117	N/A	INTRINSIC
HECTc	2143	2610	8.32e-76	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179265
AA Change: F332I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: F332I

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	396	425	1.44e-1	SMART
ANK	427	456	2.81e-4	SMART
ANK	460	489	1.55e2	SMART
low complexity region	491	510	N/A	INTRINSIC
low complexity region	631	655	N/A	INTRINSIC
low complexity region	708	724	N/A	INTRINSIC
low complexity region	822	833	N/A	INTRINSIC
Pfam:Sad1_UNC	1112	1245	1.3e-26	PFAM
low complexity region	1264	1276	N/A	INTRINSIC
Pfam:MIB_HERC2	1282	1341	5.3e-26	PFAM
low complexity region	1378	1406	N/A	INTRINSIC
low complexity region	1446	1463	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1513	1529	N/A	INTRINSIC
low complexity region	1605	1635	N/A	INTRINSIC
low complexity region	1638	1656	N/A	INTRINSIC
low complexity region	1679	1708	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
PDB:2LC3\|A	1884	1971	3e-57	PDB
low complexity region	2106	2122	N/A	INTRINSIC
HECTc	2148	2618	4.5e-72	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]

Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa1b	C	T	9: 119,148,406	G403S	probably damaging	Het
Agbl2	G	A	2: 90,810,006	V699I	probably benign	Het
Amer2	AAGGAGGAGGAGGAG	AAGGAGGAGGAG	14: 60,378,853		probably benign	Het
Bace2	A	T	16: 97,413,425	Q271L	probably damaging	Het
Btn2a2	T	C	13: 23,478,275	K493E	probably benign	Het
Ces3a	T	A	8: 105,051,564	D222E	probably benign	Het
Ckap2l	A	G	2: 129,285,842	C139R	probably benign	Het
Clip4	A	G	17: 71,831,262	H485R	probably benign	Het
Cntfr	T	A	4: 41,663,216	D197V	probably benign	Het
Efcab5	A	G	11: 77,151,921	L2P	probably damaging	Het
Elmo2	A	G	2: 165,310,212	V163A	possibly damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Flrt2	A	G	12: 95,780,426	T513A	probably benign	Het
Gm10801	GT	GTTTTT	2: 98,662,499		probably null	Het
Helz	A	G	11: 107,646,120	D947G	probably damaging	Het
Hivep2	T	A	10: 14,131,022	D1121E	probably benign	Het
Hoxa13	GG	GGCG	6: 52,260,540		probably null	Homo
Hoxd13	A	T	2: 74,668,797	Y163F	probably damaging	Het
Immt	C	A	6: 71,852,784	P158Q	probably null	Het
Kcnh5	A	G	12: 75,130,907	S142P	possibly damaging	Het
Lnpep	T	G	17: 17,538,694	H796P	probably benign	Het
Mfhas1	C	A	8: 35,590,269	R633S	possibly damaging	Het
Mmp25	A	G	17: 23,644,760	L32P	probably benign	Het
Myo15b	A	G	11: 115,881,301	D299G	probably damaging	Het
Myo18b	T	C	5: 112,790,042	E1739G	probably damaging	Het
Olfr907	T	A	9: 38,498,998	S110T	probably benign	Het
Parp9	A	G	16: 35,956,825	K147E	probably damaging	Het
Pcdha3	G	T	18: 36,947,936	R577L	probably benign	Het
Plod2	T	A	9: 92,606,569	I637N	probably damaging	Het
Polk	T	G	13: 96,495,497	S243R	probably damaging	Het
Prag1	T	C	8: 36,104,014	S584P	probably benign	Het
Prex1	A	T	2: 166,580,273	V43E	possibly damaging	Het
Rdh10	T	C	1: 16,131,184	Y294H	probably damaging	Het
Rnf126	T	A	10: 79,762,699	I28F	probably damaging	Het
Sdk2	T	A	11: 113,943,158	H66L	possibly damaging	Het
Tet1	G	T	10: 62,832,907	P1431Q	probably damaging	Het
Tmco2	T	A	4: 121,105,993	Q103L	possibly damaging	Het
Ucp3	A	T	7: 100,480,666	R172W	probably benign	Het
Unc79	A	T	12: 103,169,703	I2270F	possibly damaging	Het

Other mutations in Hectd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Hectd1	APN	12	51769108	missense	possibly damaging	0.94
IGL00402:Hectd1	APN	12	51759432	missense	probably benign
IGL00419:Hectd1	APN	12	51764035	missense	probably damaging	0.99
IGL00518:Hectd1	APN	12	51776489	splice site	probably benign
IGL00565:Hectd1	APN	12	51790398	missense	probably damaging	0.97
IGL00574:Hectd1	APN	12	51774004	missense	probably benign	0.17
IGL00576:Hectd1	APN	12	51759309	missense	probably damaging	0.99
IGL00788:Hectd1	APN	12	51748788	missense	probably damaging	0.99
IGL00978:Hectd1	APN	12	51791390	missense	possibly damaging	0.95
IGL01328:Hectd1	APN	12	51761121	missense	probably damaging	1.00
IGL01337:Hectd1	APN	12	51802274	missense	possibly damaging	0.95
IGL01634:Hectd1	APN	12	51803779	missense	probably damaging	0.98
IGL01731:Hectd1	APN	12	51802810	missense	possibly damaging	0.59
IGL01920:Hectd1	APN	12	51782554	missense	probably damaging	0.99
IGL01951:Hectd1	APN	12	51794497	nonsense	probably null
IGL01994:Hectd1	APN	12	51797942	missense	probably damaging	0.99
IGL02140:Hectd1	APN	12	51774137	missense	probably damaging	0.99
IGL02150:Hectd1	APN	12	51769191	missense	probably damaging	0.97
IGL02156:Hectd1	APN	12	51754133	splice site	probably benign
IGL02177:Hectd1	APN	12	51772320	missense	probably damaging	0.99
IGL02502:Hectd1	APN	12	51797852	missense	possibly damaging	0.77
IGL02505:Hectd1	APN	12	51800713	critical splice donor site	probably null
IGL02519:Hectd1	APN	12	51769111	missense	probably damaging	0.99
IGL02624:Hectd1	APN	12	51762450	missense	possibly damaging	0.61
IGL02833:Hectd1	APN	12	51764081	missense	probably damaging	0.96
IGL02851:Hectd1	APN	12	51767640	missense	possibly damaging	0.94
IGL02866:Hectd1	APN	12	51790613	missense	probably damaging	1.00
IGL02981:Hectd1	APN	12	51768887	missense	possibly damaging	0.70
IGL02987:Hectd1	APN	12	51744767	missense	probably damaging	1.00
IGL02999:Hectd1	APN	12	51827422	missense	possibly damaging	0.77
IGL03071:Hectd1	APN	12	51769174	missense	probably benign	0.00
IGL03078:Hectd1	APN	12	51802236	missense	probably damaging	0.98
IGL03299:Hectd1	APN	12	51800888	splice site	probably benign
3-1:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R0039:Hectd1	UTSW	12	51753825	missense	possibly damaging	0.83
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0268:Hectd1	UTSW	12	51769107	missense	probably damaging	0.99
R0268:Hectd1	UTSW	12	51769108	missense	possibly damaging	0.94
R0409:Hectd1	UTSW	12	51782556	missense	possibly damaging	0.59
R1019:Hectd1	UTSW	12	51748657	missense	probably damaging	0.99
R1072:Hectd1	UTSW	12	51761072	missense	probably benign	0.11
R1087:Hectd1	UTSW	12	51776572	missense	probably damaging	0.99
R1165:Hectd1	UTSW	12	51764164	splice site	probably benign
R1350:Hectd1	UTSW	12	51762434	missense	probably benign
R1553:Hectd1	UTSW	12	51773878	missense	probably damaging	0.98
R1666:Hectd1	UTSW	12	51753824	missense	possibly damaging	0.91
R1676:Hectd1	UTSW	12	51744788	missense	probably damaging	1.00
R1694:Hectd1	UTSW	12	51744592	missense	probably damaging	1.00
R1778:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R1856:Hectd1	UTSW	12	51744794	missense	probably damaging	1.00
R1859:Hectd1	UTSW	12	51806567	missense	probably damaging	1.00
R1884:Hectd1	UTSW	12	51800955	missense	probably benign	0.00
R1982:Hectd1	UTSW	12	51785841	missense	probably damaging	0.97
R2034:Hectd1	UTSW	12	51757116	splice site	probably null
R2061:Hectd1	UTSW	12	51794444	missense	probably damaging	0.99
R2078:Hectd1	UTSW	12	51748542	missense	probably damaging	0.99
R2176:Hectd1	UTSW	12	51745494	missense	probably damaging	1.00
R2210:Hectd1	UTSW	12	51806462	missense	probably damaging	0.99
R2248:Hectd1	UTSW	12	51806471	missense	probably damaging	0.99
R2282:Hectd1	UTSW	12	51769008	missense	possibly damaging	0.95
R2402:Hectd1	UTSW	12	51745534	missense	probably benign	0.01
R3876:Hectd1	UTSW	12	51768730	missense	probably damaging	0.98
R4027:Hectd1	UTSW	12	51802436	critical splice acceptor site	probably null
R4085:Hectd1	UTSW	12	51774750	missense	possibly damaging	0.93
R4115:Hectd1	UTSW	12	51768723	nonsense	probably null
R4116:Hectd1	UTSW	12	51768723	nonsense	probably null
R4169:Hectd1	UTSW	12	51790225	missense	probably damaging	0.97
R4434:Hectd1	UTSW	12	51752052	missense	probably damaging	1.00
R4507:Hectd1	UTSW	12	51790493	missense	probably damaging	0.97
R4578:Hectd1	UTSW	12	51751932	missense	probably damaging	1.00
R4579:Hectd1	UTSW	12	51744573	missense	probably damaging	0.97
R4709:Hectd1	UTSW	12	51787912	missense	possibly damaging	0.94
R4812:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R4883:Hectd1	UTSW	12	51784247	nonsense	probably null
R4885:Hectd1	UTSW	12	51800722	missense	probably damaging	0.97
R4975:Hectd1	UTSW	12	51762497	missense	probably benign	0.02
R4983:Hectd1	UTSW	12	51784262	missense	probably benign	0.01
R5007:Hectd1	UTSW	12	51802660	missense	possibly damaging	0.95
R5046:Hectd1	UTSW	12	51750388	missense	probably damaging	1.00
R5062:Hectd1	UTSW	12	51744879	missense	probably damaging	0.98
R5164:Hectd1	UTSW	12	51827489	start codon destroyed	probably null	0.60
R5213:Hectd1	UTSW	12	51802533	critical splice donor site	probably null
R5776:Hectd1	UTSW	12	51764114	missense	possibly damaging	0.91
R5846:Hectd1	UTSW	12	51773835	missense	probably damaging	0.99
R5907:Hectd1	UTSW	12	51798754	missense	probably damaging	0.98
R5911:Hectd1	UTSW	12	51802252	missense	probably damaging	0.99
R5919:Hectd1	UTSW	12	51769072	missense	probably damaging	0.98
R6051:Hectd1	UTSW	12	51754104	missense	probably benign
R6141:Hectd1	UTSW	12	51746092	critical splice donor site	probably null
R6172:Hectd1	UTSW	12	51769282	missense	probably damaging	1.00
R6194:Hectd1	UTSW	12	51748445	missense	probably damaging	0.99
R6356:Hectd1	UTSW	12	51744619	missense	probably damaging	1.00
R6795:Hectd1	UTSW	12	51794487	missense	possibly damaging	0.94
R6909:Hectd1	UTSW	12	51764162	splice site	probably null
R6971:Hectd1	UTSW	12	51748743	nonsense	probably null
R7079:Hectd1	UTSW	12	51787855	missense	possibly damaging	0.96
R7104:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R7171:Hectd1	UTSW	12	51759297	missense	probably damaging	0.99
R7296:Hectd1	UTSW	12	51785852	missense	possibly damaging	0.73
R7346:Hectd1	UTSW	12	51750321	missense	probably benign
R7355:Hectd1	UTSW	12	51791298	missense	possibly damaging	0.72
R7468:Hectd1	UTSW	12	51744805	splice site	probably null
R7531:Hectd1	UTSW	12	51806367	missense	probably benign	0.33
R7532:Hectd1	UTSW	12	51790450	missense	probably damaging	0.98
R7755:Hectd1	UTSW	12	51802220	missense	possibly damaging	0.86
R7807:Hectd1	UTSW	12	51745388	missense	probably damaging	1.00
R7842:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99
R7922:Hectd1	UTSW	12	51790195	nonsense	probably null
R8059:Hectd1	UTSW	12	51790378	missense	possibly damaging	0.53
R8085:Hectd1	UTSW	12	51748896	missense	probably damaging	0.97
R8145:Hectd1	UTSW	12	51784233	missense	possibly damaging	0.72
R8157:Hectd1	UTSW	12	51791290	missense	possibly damaging	0.53
R8405:Hectd1	UTSW	12	51827395	missense	probably benign	0.01
R8505:Hectd1	UTSW	12	51750362	missense	probably damaging	1.00
R8511:Hectd1	UTSW	12	51787871	missense	probably benign	0.01
R8697:Hectd1	UTSW	12	51772537	critical splice donor site	probably benign
R8725:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8727:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8911:Hectd1	UTSW	12	51748833	missense	probably damaging	0.99
R8983:Hectd1	UTSW	12	51744627	missense	probably damaging	0.97
R9037:Hectd1	UTSW	12	51785882	missense	possibly damaging	0.85
R9219:Hectd1	UTSW	12	51753829	missense	probably damaging	0.99
R9413:Hectd1	UTSW	12	51746097	nonsense	probably null
R9456:Hectd1	UTSW	12	51785801	missense	probably benign
R9513:Hectd1	UTSW	12	51769296	missense	possibly damaging	0.92
R9640:Hectd1	UTSW	12	51748414	nonsense	probably null
R9641:Hectd1	UTSW	12	51769264	missense	probably benign	0.00
R9713:Hectd1	UTSW	12	51776545	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTGACCTCCTGTGTCAATCG -3'
(R):5'- AGAGGCTCTCCACTAGTAACAC -3'

Sequencing Primer
(F):5'- CCTGTGTCAATCGCATCTATGAGAG -3'
(R):5'- CACACGTAAGGATGCTTCTTGGATC -3'

Posted On

2016-10-24