Incidental Mutation 'R5535:Fkbpl'
ID434798
Institutional Source Beutler Lab
Gene Symbol Fkbpl
Ensembl Gene ENSMUSG00000033739
Gene NameFK506 binding protein-like
SynonymsWAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34644764-34646324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34645329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 24 (A24T)
Ref Sequence ENSEMBL: ENSMUSP00000037273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]
Predicted Effect probably benign
Transcript: ENSMUST00000015605
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

DomainStartEndE-ValueType
TPR 208 241 2.92e1 SMART
TPR 250 283 4.77e-2 SMART
TPR 284 317 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173984
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174600
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Predicted Effect probably benign
Transcript: ENSMUST00000174796
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Fkbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Fkbpl APN 17 34645744 missense probably damaging 1.00
IGL02129:Fkbpl APN 17 34645978 missense probably damaging 0.99
IGL02322:Fkbpl APN 17 34645324 missense probably benign 0.00
IGL03331:Fkbpl APN 17 34645687 missense probably damaging 1.00
IGL03347:Fkbpl APN 17 34646313 unclassified probably benign
R0278:Fkbpl UTSW 17 34645410 nonsense probably null
R0314:Fkbpl UTSW 17 34646052 missense possibly damaging 0.62
R0540:Fkbpl UTSW 17 34645359 missense probably benign
R0607:Fkbpl UTSW 17 34645359 missense probably benign
R1866:Fkbpl UTSW 17 34645823 missense possibly damaging 0.50
R4483:Fkbpl UTSW 17 34646295 missense probably damaging 1.00
R4746:Fkbpl UTSW 17 34645329 missense probably benign
R4795:Fkbpl UTSW 17 34645329 missense probably benign
R4796:Fkbpl UTSW 17 34645329 missense probably benign
R4839:Fkbpl UTSW 17 34645865 missense probably benign
R5268:Fkbpl UTSW 17 34645329 missense probably benign
R5290:Fkbpl UTSW 17 34645329 missense probably benign
R5357:Fkbpl UTSW 17 34645329 missense probably benign
R5358:Fkbpl UTSW 17 34645329 missense probably benign
R5359:Fkbpl UTSW 17 34645329 missense probably benign
R5360:Fkbpl UTSW 17 34645329 missense probably benign
R5361:Fkbpl UTSW 17 34645329 missense probably benign
R5363:Fkbpl UTSW 17 34645329 missense probably benign
R5406:Fkbpl UTSW 17 34645329 missense probably benign
R5435:Fkbpl UTSW 17 34645329 missense probably benign
R5533:Fkbpl UTSW 17 34645329 missense probably benign
R5722:Fkbpl UTSW 17 34645329 missense probably benign
R5723:Fkbpl UTSW 17 34645329 missense probably benign
R5760:Fkbpl UTSW 17 34645329 missense probably benign
R5861:Fkbpl UTSW 17 34645329 missense probably benign
R5941:Fkbpl UTSW 17 34645329 missense probably benign
R6109:Fkbpl UTSW 17 34645329 missense probably benign
R6124:Fkbpl UTSW 17 34645329 missense probably benign
R6146:Fkbpl UTSW 17 34645329 missense probably benign
R6148:Fkbpl UTSW 17 34645329 missense probably benign
R6185:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34646179 missense probably benign 0.12
R6344:Fkbpl UTSW 17 34645570 missense probably damaging 1.00
R6481:Fkbpl UTSW 17 34645414 missense possibly damaging 0.95
R6564:Fkbpl UTSW 17 34646266 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CGAGGAGTCTTAACTAGGAATTCTG -3'
(R):5'- GTGCTCTGCCATCTCATTGG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'
Posted On2016-10-24