Incidental Mutation 'R5535:Clip4'
ID434799
Institutional Source Beutler Lab
Gene Symbol Clip4
Ensembl Gene ENSMUSG00000024059
Gene NameCAP-GLY domain containing linker protein family, member 4
Synonyms1700024K14Rik, Rsnl2, 1700074B05Rik, 4833417L20Rik, 5830409B12Rik
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71768473-71864273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71831262 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 485 (H485R)
Ref Sequence ENSEMBL: ENSMUSP00000154878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024854] [ENSMUST00000229304] [ENSMUST00000229874] [ENSMUST00000229952] [ENSMUST00000230305] [ENSMUST00000230333] [ENSMUST00000230747] [ENSMUST00000230749] [ENSMUST00000231105]
Predicted Effect probably benign
Transcript: ENSMUST00000024854
AA Change: H485R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024854
Gene: ENSMUSG00000024059
AA Change: H485R

DomainStartEndE-ValueType
ANK 106 144 4.58e2 SMART
ANK 149 180 3.26e0 SMART
ANK 186 215 3.26e0 SMART
CAP_GLY 285 350 6.63e-34 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 389 403 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 469 478 N/A INTRINSIC
CAP_GLY 486 551 5.52e-31 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
CAP_GLY 624 690 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229014
Predicted Effect probably benign
Transcript: ENSMUST00000229304
Predicted Effect probably benign
Transcript: ENSMUST00000229874
AA Change: H485R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229903
Predicted Effect probably benign
Transcript: ENSMUST00000229952
AA Change: H438R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000230160
AA Change: H177R
Predicted Effect probably benign
Transcript: ENSMUST00000230305
AA Change: H485R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230333
AA Change: H485R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230747
Predicted Effect probably benign
Transcript: ENSMUST00000230749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230845
Predicted Effect probably benign
Transcript: ENSMUST00000231105
Predicted Effect unknown
Transcript: ENSMUST00000231131
AA Change: H67R
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Clip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Clip4 APN 17 71849942 missense probably damaging 1.00
IGL01011:Clip4 APN 17 71849939 missense probably benign 0.02
IGL01086:Clip4 APN 17 71824794 missense probably benign 0.00
IGL01712:Clip4 APN 17 71799041 missense probably damaging 1.00
IGL01833:Clip4 APN 17 71827790 unclassified probably benign
IGL02150:Clip4 APN 17 71799076 missense probably damaging 1.00
IGL02378:Clip4 APN 17 71837726 missense possibly damaging 0.94
IGL02597:Clip4 APN 17 71849970 splice site probably benign
IGL02676:Clip4 APN 17 71828621 missense probably damaging 1.00
PIT4243001:Clip4 UTSW 17 71806728 missense probably damaging 0.98
R0525:Clip4 UTSW 17 71799098 critical splice donor site probably null
R0737:Clip4 UTSW 17 71837699 nonsense probably null
R1791:Clip4 UTSW 17 71801942 splice site probably benign
R1908:Clip4 UTSW 17 71837749 missense probably damaging 1.00
R2290:Clip4 UTSW 17 71810953 missense possibly damaging 0.96
R3701:Clip4 UTSW 17 71799008 missense probably damaging 0.96
R4001:Clip4 UTSW 17 71799076 missense probably damaging 1.00
R4013:Clip4 UTSW 17 71856546 nonsense probably null
R4589:Clip4 UTSW 17 71810867 nonsense probably null
R4837:Clip4 UTSW 17 71834222 missense probably damaging 1.00
R5174:Clip4 UTSW 17 71810962 missense probably damaging 1.00
R5239:Clip4 UTSW 17 71799077 missense probably damaging 1.00
R5298:Clip4 UTSW 17 71834225 missense probably damaging 1.00
R5667:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5671:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5730:Clip4 UTSW 17 71810959 missense probably damaging 1.00
R5768:Clip4 UTSW 17 71806499 splice site probably null
R5913:Clip4 UTSW 17 71824765 missense probably benign 0.00
R5974:Clip4 UTSW 17 71831247 missense probably damaging 1.00
R5996:Clip4 UTSW 17 71856310 missense probably damaging 0.99
R6176:Clip4 UTSW 17 71806633 nonsense probably null
R6371:Clip4 UTSW 17 71856464 missense probably damaging 1.00
R6386:Clip4 UTSW 17 71834194 nonsense probably null
R7296:Clip4 UTSW 17 71790001 missense probably damaging 0.99
R7546:Clip4 UTSW 17 71828702 missense possibly damaging 0.85
R7548:Clip4 UTSW 17 71789968 missense probably benign
R7616:Clip4 UTSW 17 71834273 missense probably benign 0.00
R8054:Clip4 UTSW 17 71834273 missense possibly damaging 0.68
R8056:Clip4 UTSW 17 71803592 missense probably damaging 1.00
R8486:Clip4 UTSW 17 71863844 utr 3 prime probably benign
R8697:Clip4 UTSW 17 71856275 missense possibly damaging 0.80
R8812:Clip4 UTSW 17 71800805 nonsense probably null
R8929:Clip4 UTSW 17 71831208 missense probably damaging 1.00
R8942:Clip4 UTSW 17 71863773 missense probably benign 0.03
Z1177:Clip4 UTSW 17 71799097 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCAGACAAGTTAGAACACGTG -3'
(R):5'- AGCTGTATCACTTTCCACACAC -3'

Sequencing Primer
(F):5'- CACGTGAAGTGAGTTTTAAA -3'
(R):5'- CCAGGGAGAGAGAACCTCC -3'
Posted On2016-10-24