Incidental Mutation 'R0179:Trerf1'
ID43480
Institutional Source Beutler Lab
Gene Symbol Trerf1
Ensembl Gene ENSMUSG00000064043
Gene Nametranscriptional regulating factor 1
SynonymsTrep132, 9430096I18Rik, Trep-132
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R0179 (G1)
Quality Score140
Status Validated (trace)
Chromosome17
Chromosomal Location47140875-47361958 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 47316662 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077951
SMART Domains Protein: ENSMUSP00000077103
Gene: ENSMUSG00000064043

DomainStartEndE-ValueType
low complexity region 262 279 N/A INTRINSIC
low complexity region 291 342 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
ZnF_C2H2 512 534 1.2e-3 SMART
low complexity region 552 580 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
low complexity region 690 704 N/A INTRINSIC
low complexity region 732 742 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
ELM2 807 863 7.65e-13 SMART
SANT 912 960 2.18e-5 SMART
coiled coil region 981 1005 N/A INTRINSIC
ZnF_C2H2 1039 1063 2.75e-3 SMART
low complexity region 1092 1106 N/A INTRINSIC
ZnF_C2H2 1112 1134 1.1e-2 SMART
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1182 1200 N/A INTRINSIC
low complexity region 1208 1222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191153
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcriptional regulating protein which interacts with CBP/p300 to regulate the human gene CYP11A1. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Trerf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Trerf1 APN 17 47319575 unclassified noncoding transcript
IGL01753:Trerf1 APN 17 47315436 exon noncoding transcript
IGL02172:Trerf1 APN 17 47317817 exon noncoding transcript
IGL02266:Trerf1 APN 17 47315405 exon noncoding transcript
IGL02370:Trerf1 APN 17 47314461 exon noncoding transcript
IGL02613:Trerf1 APN 17 47348840 exon noncoding transcript
R0284:Trerf1 UTSW 17 47319545 unclassified noncoding transcript
R0359:Trerf1 UTSW 17 47341136 exon noncoding transcript
R0689:Trerf1 UTSW 17 47319374 unclassified noncoding transcript
R1460:Trerf1 UTSW 17 47317845 exon noncoding transcript
R1727:Trerf1 UTSW 17 47341166 exon noncoding transcript
R4222:Trerf1 UTSW 17 47314801 exon noncoding transcript
R4562:Trerf1 UTSW 17 47327071 exon noncoding transcript
R4770:Trerf1 UTSW 17 47319655 unclassified noncoding transcript
R5366:Trerf1 UTSW 17 47315190 exon noncoding transcript
R5919:Trerf1 UTSW 17 47323282 unclassified noncoding transcript
R5963:Trerf1 UTSW 17 47314337 exon noncoding transcript
R5975:Trerf1 UTSW 17 47314271 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGCAGTCACACCTACGAAGTTCTTG -3'
(R):5'- ACAGCAATGCCTGCCTTACTGG -3'

Sequencing Primer
(F):5'- ATGGACCCTGTTAGTGCAGAC -3'
(R):5'- TCCTTGAAACTCTGACCTTGG -3'
Posted On2013-05-24