Incidental Mutation 'R5536:Zbtb40'
ID434817
Institutional Source Beutler Lab
Gene Symbol Zbtb40
Ensembl Gene ENSMUSG00000060862
Gene Namezinc finger and BTB domain containing 40
Synonyms
MMRRC Submission 043094-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5536 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136979732-137048801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136987331 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1049 (P1049Q)
Ref Sequence ENSEMBL: ENSMUSP00000061899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049583]
Predicted Effect probably damaging
Transcript: ENSMUST00000049583
AA Change: P1049Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: P1049Q

DomainStartEndE-ValueType
low complexity region 8 14 N/A INTRINSIC
BTB 24 117 3.39e-18 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 525 533 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
ZnF_C2H2 754 774 4.86e1 SMART
low complexity region 786 801 N/A INTRINSIC
ZnF_C2H2 825 848 1.16e-1 SMART
ZnF_C2H2 854 876 1.1e-2 SMART
ZnF_C2H2 882 905 1.16e-1 SMART
ZnF_C2H2 911 933 1.2e-3 SMART
ZnF_C2H2 939 962 8.81e-2 SMART
ZnF_C2H2 969 992 7.05e-1 SMART
ZnF_C2H2 997 1019 1.47e-3 SMART
ZnF_C2H2 1025 1047 2.86e-1 SMART
ZnF_C2H2 1065 1088 6.67e-2 SMART
ZnF_C2H2 1094 1117 6.23e-2 SMART
ZnF_C2H2 1123 1146 1.53e-1 SMART
ZnF_C2H2 1154 1177 1.56e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000218160
AA Change: P140Q
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,066,388 G446V possibly damaging Het
Aadac T G 3: 60,039,563 N227K probably benign Het
Acap1 C T 11: 69,889,307 G74R probably benign Het
Adrm1 A G 2: 180,172,188 probably benign Het
Appl1 G C 14: 26,923,780 S691* probably null Het
Atp2a2 T C 5: 122,457,182 D1035G probably benign Het
AW551984 A G 9: 39,592,873 I599T probably benign Het
Col23a1 C A 11: 51,567,949 D304E probably damaging Het
Csmd1 T C 8: 16,288,660 R478G probably damaging Het
Dnah7a T C 1: 53,425,253 N3660D probably benign Het
Drosha T A 15: 12,929,711 Y1331N possibly damaging Het
E2f6 T G 12: 16,824,684 S256A probably benign Het
Evc A G 5: 37,326,583 probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Galnt2 T C 8: 124,323,673 C91R probably damaging Het
Gm3095 G T 14: 3,964,502 M73I probably benign Het
Gpr179 T A 11: 97,343,815 Q480L probably damaging Het
Gucy2g T A 19: 55,237,927 I186F probably benign Het
Hmcn1 T A 1: 150,755,291 I919F probably benign Het
Kdm3a A C 6: 71,611,936 V363G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lama5 C T 2: 180,189,349 R1839H probably damaging Het
Lpo T C 11: 87,816,563 D208G probably damaging Het
Lpp A G 16: 24,845,206 D411G possibly damaging Het
Marco T C 1: 120,504,735 S8G possibly damaging Het
Mthfr T C 4: 148,044,483 F171S probably damaging Het
Nlrx1 A T 9: 44,263,886 S198T probably damaging Het
Nol10 C A 12: 17,416,137 S511* probably null Het
Nup153 T C 13: 46,683,009 T1375A probably benign Het
Obscn A G 11: 59,107,871 S1367P probably damaging Het
Olfr1269 A G 2: 90,118,839 V253A probably benign Het
Pcdha7 G A 18: 36,975,250 V443M probably damaging Het
Plekha1 G T 7: 130,909,601 R305I probably damaging Het
Psmb2 T A 4: 126,684,209 I60N probably damaging Het
Rad17 C A 13: 100,631,104 G330C probably damaging Het
Slc5a6 A G 5: 31,043,102 S80P probably damaging Het
Srgap2 T A 1: 131,300,390 probably null Het
Taf8 C A 17: 47,494,482 R164L possibly damaging Het
Tmem87a C A 2: 120,397,430 D79Y probably damaging Het
Tmtc4 G A 14: 122,932,879 R574W probably benign Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Usf3 A G 16: 44,217,370 T738A probably benign Het
Vmn2r54 A C 7: 12,632,416 V197G probably benign Het
Zfp551 A T 7: 12,415,561 S640R possibly damaging Het
Zfp932 T A 5: 110,009,847 C470* probably null Het
Zkscan8 T C 13: 21,526,668 I91V probably damaging Het
Zmat4 T C 8: 23,748,492 V30A probably damaging Het
Other mutations in Zbtb40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zbtb40 APN 4 136987340 missense probably damaging 0.99
IGL00573:Zbtb40 APN 4 137018078 missense probably benign 0.00
IGL00774:Zbtb40 APN 4 136994524 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0334:Zbtb40 UTSW 4 136986556 missense probably damaging 1.00
R0393:Zbtb40 UTSW 4 137018531 missense probably benign 0.09
R0482:Zbtb40 UTSW 4 136983228 missense probably damaging 1.00
R1457:Zbtb40 UTSW 4 136984837 missense possibly damaging 0.81
R1846:Zbtb40 UTSW 4 137007839 missense probably benign 0.00
R2153:Zbtb40 UTSW 4 136991635 missense probably damaging 1.00
R2206:Zbtb40 UTSW 4 137017285 nonsense probably null
R2291:Zbtb40 UTSW 4 136985017 missense possibly damaging 0.78
R2406:Zbtb40 UTSW 4 136998568 missense probably benign 0.34
R3707:Zbtb40 UTSW 4 136999568 missense probably damaging 1.00
R4131:Zbtb40 UTSW 4 136995396 missense probably benign 0.00
R4243:Zbtb40 UTSW 4 137018549 missense probably benign 0.00
R4424:Zbtb40 UTSW 4 136998694 missense probably damaging 0.96
R4725:Zbtb40 UTSW 4 137018761 utr 5 prime probably benign
R4784:Zbtb40 UTSW 4 137007097 missense probably damaging 1.00
R4795:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4796:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4838:Zbtb40 UTSW 4 137001216 missense probably benign 0.15
R4859:Zbtb40 UTSW 4 136988759 missense probably damaging 0.98
R4883:Zbtb40 UTSW 4 137000930 missense probably benign 0.09
R5001:Zbtb40 UTSW 4 136996150 missense probably damaging 1.00
R5030:Zbtb40 UTSW 4 136997952 missense probably benign 0.00
R5060:Zbtb40 UTSW 4 137001293 missense possibly damaging 0.71
R5529:Zbtb40 UTSW 4 136983163 missense possibly damaging 0.90
R5589:Zbtb40 UTSW 4 136995283 missense probably damaging 1.00
R6114:Zbtb40 UTSW 4 136988691 missense probably damaging 1.00
R6393:Zbtb40 UTSW 4 136984866 missense probably null
R7208:Zbtb40 UTSW 4 136999626 splice site probably null
R7406:Zbtb40 UTSW 4 137000894 missense probably benign 0.29
R7722:Zbtb40 UTSW 4 136991518 missense probably damaging 0.98
R7803:Zbtb40 UTSW 4 137017327 missense probably benign
R8292:Zbtb40 UTSW 4 136999567 missense probably damaging 1.00
R8735:Zbtb40 UTSW 4 136998646 missense probably damaging 1.00
R8890:Zbtb40 UTSW 4 136998586 missense probably damaging 1.00
RF014:Zbtb40 UTSW 4 137017306 missense probably benign 0.20
Z1176:Zbtb40 UTSW 4 136995463 missense probably damaging 1.00
Z1177:Zbtb40 UTSW 4 137018024 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGCTGTGCTAGGGAAGAG -3'
(R):5'- ACATCGTCTCCTAGGCTTGTG -3'

Sequencing Primer
(F):5'- AATTGCCACGGTGCCTG -3'
(R):5'- CTCCTAGGCTTGTGTGAGTGAAG -3'
Posted On2016-10-24