Incidental Mutation 'R5536:Kdm3a'
ID434822
Institutional Source Beutler Lab
Gene Symbol Kdm3a
Ensembl Gene ENSMUSG00000053470
Gene Namelysine (K)-specific demethylase 3A
SynonymsC230043E16Rik, Jmjd1a, Tsga, 1700105C21Rik, Jmjd1
MMRRC Submission 043094-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5536 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71588972-71632990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 71611936 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 363 (V363G)
Ref Sequence ENSEMBL: ENSMUSP00000145719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065509] [ENSMUST00000167220] [ENSMUST00000205289] [ENSMUST00000207023]
Predicted Effect probably benign
Transcript: ENSMUST00000065509
AA Change: V363G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000065716
Gene: ENSMUSG00000053470
AA Change: V363G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167220
AA Change: V363G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128789
Gene: ENSMUSG00000053470
AA Change: V363G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205289
AA Change: V363G

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206704
Predicted Effect unknown
Transcript: ENSMUST00000206916
AA Change: V23G
Predicted Effect probably benign
Transcript: ENSMUST00000207023
AA Change: V363G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein that contains a jumonji domain and may play a role in hormone-dependent transcriptional activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Male mice homozygous for a hypomorphic allele display infertility, oligoasthenoteratozoospermia, small testis, and impaired spermiogenesis. Mice homozygous for a null allele exhibit abnormal spermatogenesis and obesity associated with hyperlipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,066,388 G446V possibly damaging Het
Aadac T G 3: 60,039,563 N227K probably benign Het
Acap1 C T 11: 69,889,307 G74R probably benign Het
Adrm1 A G 2: 180,172,188 probably benign Het
Appl1 G C 14: 26,923,780 S691* probably null Het
Atp2a2 T C 5: 122,457,182 D1035G probably benign Het
AW551984 A G 9: 39,592,873 I599T probably benign Het
Col23a1 C A 11: 51,567,949 D304E probably damaging Het
Csmd1 T C 8: 16,288,660 R478G probably damaging Het
Dnah7a T C 1: 53,425,253 N3660D probably benign Het
Drosha T A 15: 12,929,711 Y1331N possibly damaging Het
E2f6 T G 12: 16,824,684 S256A probably benign Het
Evc A G 5: 37,326,583 probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Galnt2 T C 8: 124,323,673 C91R probably damaging Het
Gm3095 G T 14: 3,964,502 M73I probably benign Het
Gpr179 T A 11: 97,343,815 Q480L probably damaging Het
Gucy2g T A 19: 55,237,927 I186F probably benign Het
Hmcn1 T A 1: 150,755,291 I919F probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lama5 C T 2: 180,189,349 R1839H probably damaging Het
Lpo T C 11: 87,816,563 D208G probably damaging Het
Lpp A G 16: 24,845,206 D411G possibly damaging Het
Marco T C 1: 120,504,735 S8G possibly damaging Het
Mthfr T C 4: 148,044,483 F171S probably damaging Het
Nlrx1 A T 9: 44,263,886 S198T probably damaging Het
Nol10 C A 12: 17,416,137 S511* probably null Het
Nup153 T C 13: 46,683,009 T1375A probably benign Het
Obscn A G 11: 59,107,871 S1367P probably damaging Het
Olfr1269 A G 2: 90,118,839 V253A probably benign Het
Pcdha7 G A 18: 36,975,250 V443M probably damaging Het
Plekha1 G T 7: 130,909,601 R305I probably damaging Het
Psmb2 T A 4: 126,684,209 I60N probably damaging Het
Rad17 C A 13: 100,631,104 G330C probably damaging Het
Slc5a6 A G 5: 31,043,102 S80P probably damaging Het
Srgap2 T A 1: 131,300,390 probably null Het
Taf8 C A 17: 47,494,482 R164L possibly damaging Het
Tmem87a C A 2: 120,397,430 D79Y probably damaging Het
Tmtc4 G A 14: 122,932,879 R574W probably benign Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Usf3 A G 16: 44,217,370 T738A probably benign Het
Vmn2r54 A C 7: 12,632,416 V197G probably benign Het
Zbtb40 G T 4: 136,987,331 P1049Q probably damaging Het
Zfp551 A T 7: 12,415,561 S640R possibly damaging Het
Zfp932 T A 5: 110,009,847 C470* probably null Het
Zkscan8 T C 13: 21,526,668 I91V probably damaging Het
Zmat4 T C 8: 23,748,492 V30A probably damaging Het
Other mutations in Kdm3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Kdm3a APN 6 71600117 missense probably damaging 1.00
IGL02219:Kdm3a APN 6 71600734 missense probably benign 0.01
IGL02423:Kdm3a APN 6 71614003 splice site probably benign
IGL02427:Kdm3a APN 6 71592200 splice site probably benign
IGL02519:Kdm3a APN 6 71611586 missense probably benign 0.04
IGL03143:Kdm3a APN 6 71596861 missense probably damaging 0.98
IGL03279:Kdm3a APN 6 71611675 missense probably benign
R0194:Kdm3a UTSW 6 71624594 missense probably null 0.44
R0408:Kdm3a UTSW 6 71611679 missense probably benign 0.00
R0426:Kdm3a UTSW 6 71600755 missense probably damaging 1.00
R0608:Kdm3a UTSW 6 71620046 missense probably benign 0.01
R1175:Kdm3a UTSW 6 71600027 missense possibly damaging 0.94
R1835:Kdm3a UTSW 6 71613956 missense probably benign 0.14
R3821:Kdm3a UTSW 6 71611677 missense probably benign 0.00
R5083:Kdm3a UTSW 6 71621362 missense probably damaging 1.00
R5903:Kdm3a UTSW 6 71632250 start gained probably benign
R5965:Kdm3a UTSW 6 71621380 missense probably benign 0.21
R6236:Kdm3a UTSW 6 71611657 missense probably benign 0.00
R6541:Kdm3a UTSW 6 71594533 missense possibly damaging 0.69
R6666:Kdm3a UTSW 6 71611990 missense probably benign 0.00
R7090:Kdm3a UTSW 6 71595545 missense possibly damaging 0.69
R7112:Kdm3a UTSW 6 71632170 missense probably benign
R7136:Kdm3a UTSW 6 71611780 missense probably benign 0.00
R7163:Kdm3a UTSW 6 71632077 missense probably damaging 1.00
R7608:Kdm3a UTSW 6 71600747 missense probably benign 0.01
R7614:Kdm3a UTSW 6 71591953 missense possibly damaging 0.82
R7683:Kdm3a UTSW 6 71599454 missense probably benign
R7687:Kdm3a UTSW 6 71599492 missense possibly damaging 0.64
R7868:Kdm3a UTSW 6 71595489 missense probably benign 0.31
R8447:Kdm3a UTSW 6 71611897 missense probably benign
RF053:Kdm3a UTSW 6 71632049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAGCACTCCTTTGGAAG -3'
(R):5'- CAGGGAACGTGTAGGATTGC -3'

Sequencing Primer
(F):5'- CCTTTGGAAGGCCAGTGACTG -3'
(R):5'- GTGTAAGATACTTTTCTCAACCCCAG -3'
Posted On2016-10-24