Incidental Mutation 'R5536:Appl1'
ID434843
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
MMRRC Submission 043094-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R5536 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to C at 26923780 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 691 (S691*)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect probably null
Transcript: ENSMUST00000036570
AA Change: S691*
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: S691*

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223843
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,066,388 G446V possibly damaging Het
Aadac T G 3: 60,039,563 N227K probably benign Het
Acap1 C T 11: 69,889,307 G74R probably benign Het
Adrm1 A G 2: 180,172,188 probably benign Het
Atp2a2 T C 5: 122,457,182 D1035G probably benign Het
AW551984 A G 9: 39,592,873 I599T probably benign Het
Col23a1 C A 11: 51,567,949 D304E probably damaging Het
Csmd1 T C 8: 16,288,660 R478G probably damaging Het
Dnah7a T C 1: 53,425,253 N3660D probably benign Het
Drosha T A 15: 12,929,711 Y1331N possibly damaging Het
E2f6 T G 12: 16,824,684 S256A probably benign Het
Evc A G 5: 37,326,583 probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Galnt2 T C 8: 124,323,673 C91R probably damaging Het
Gm3095 G T 14: 3,964,502 M73I probably benign Het
Gpr179 T A 11: 97,343,815 Q480L probably damaging Het
Gucy2g T A 19: 55,237,927 I186F probably benign Het
Hmcn1 T A 1: 150,755,291 I919F probably benign Het
Kdm3a A C 6: 71,611,936 V363G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lama5 C T 2: 180,189,349 R1839H probably damaging Het
Lpo T C 11: 87,816,563 D208G probably damaging Het
Lpp A G 16: 24,845,206 D411G possibly damaging Het
Marco T C 1: 120,504,735 S8G possibly damaging Het
Mthfr T C 4: 148,044,483 F171S probably damaging Het
Nlrx1 A T 9: 44,263,886 S198T probably damaging Het
Nol10 C A 12: 17,416,137 S511* probably null Het
Nup153 T C 13: 46,683,009 T1375A probably benign Het
Obscn A G 11: 59,107,871 S1367P probably damaging Het
Olfr1269 A G 2: 90,118,839 V253A probably benign Het
Pcdha7 G A 18: 36,975,250 V443M probably damaging Het
Plekha1 G T 7: 130,909,601 R305I probably damaging Het
Psmb2 T A 4: 126,684,209 I60N probably damaging Het
Rad17 C A 13: 100,631,104 G330C probably damaging Het
Slc5a6 A G 5: 31,043,102 S80P probably damaging Het
Srgap2 T A 1: 131,300,390 probably null Het
Taf8 C A 17: 47,494,482 R164L possibly damaging Het
Tmem87a C A 2: 120,397,430 D79Y probably damaging Het
Tmtc4 G A 14: 122,932,879 R574W probably benign Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Usf3 A G 16: 44,217,370 T738A probably benign Het
Vmn2r54 A C 7: 12,632,416 V197G probably benign Het
Zbtb40 G T 4: 136,987,331 P1049Q probably damaging Het
Zfp551 A T 7: 12,415,561 S640R possibly damaging Het
Zfp932 T A 5: 110,009,847 C470* probably null Het
Zkscan8 T C 13: 21,526,668 I91V probably damaging Het
Zmat4 T C 8: 23,748,492 V30A probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8129:Appl1 UTSW 14 26949509 missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGAAATGTTCGCTATAACCG -3'
(R):5'- CAAGATTGGAACAGCTCTCATG -3'

Sequencing Primer
(F):5'- CGCTATAACCGGTTATCAAGTTCAG -3'
(R):5'- CTCATGTATAGTAGAGCTCCATCGG -3'
Posted On2016-10-24