Incidental Mutation 'R5536:Tmtc4'
ID434844
Institutional Source Beutler Lab
Gene Symbol Tmtc4
Ensembl Gene ENSMUSG00000041594
Gene Nametransmembrane and tetratricopeptide repeat containing 4
Synonyms
MMRRC Submission 043094-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5536 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location122918971-122984035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122932879 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 574 (R574W)
Ref Sequence ENSEMBL: ENSMUSP00000121523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037726] [ENSMUST00000126867] [ENSMUST00000143189] [ENSMUST00000148661]
Predicted Effect probably benign
Transcript: ENSMUST00000037726
AA Change: R574W

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046368
Gene: ENSMUSG00000041594
AA Change: R574W

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126494
Predicted Effect probably benign
Transcript: ENSMUST00000126867
AA Change: R574W

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116379
Gene: ENSMUSG00000041594
AA Change: R574W

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135917
Predicted Effect probably benign
Transcript: ENSMUST00000143189
SMART Domains Protein: ENSMUSP00000116480
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148661
AA Change: R574W

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121523
Gene: ENSMUSG00000041594
AA Change: R574W

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 292 366 4.4e-36 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162218
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,066,388 G446V possibly damaging Het
Aadac T G 3: 60,039,563 N227K probably benign Het
Acap1 C T 11: 69,889,307 G74R probably benign Het
Adrm1 A G 2: 180,172,188 probably benign Het
Appl1 G C 14: 26,923,780 S691* probably null Het
Atp2a2 T C 5: 122,457,182 D1035G probably benign Het
AW551984 A G 9: 39,592,873 I599T probably benign Het
Col23a1 C A 11: 51,567,949 D304E probably damaging Het
Csmd1 T C 8: 16,288,660 R478G probably damaging Het
Dnah7a T C 1: 53,425,253 N3660D probably benign Het
Drosha T A 15: 12,929,711 Y1331N possibly damaging Het
E2f6 T G 12: 16,824,684 S256A probably benign Het
Evc A G 5: 37,326,583 probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Galnt2 T C 8: 124,323,673 C91R probably damaging Het
Gm3095 G T 14: 3,964,502 M73I probably benign Het
Gpr179 T A 11: 97,343,815 Q480L probably damaging Het
Gucy2g T A 19: 55,237,927 I186F probably benign Het
Hmcn1 T A 1: 150,755,291 I919F probably benign Het
Kdm3a A C 6: 71,611,936 V363G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lama5 C T 2: 180,189,349 R1839H probably damaging Het
Lpo T C 11: 87,816,563 D208G probably damaging Het
Lpp A G 16: 24,845,206 D411G possibly damaging Het
Marco T C 1: 120,504,735 S8G possibly damaging Het
Mthfr T C 4: 148,044,483 F171S probably damaging Het
Nlrx1 A T 9: 44,263,886 S198T probably damaging Het
Nol10 C A 12: 17,416,137 S511* probably null Het
Nup153 T C 13: 46,683,009 T1375A probably benign Het
Obscn A G 11: 59,107,871 S1367P probably damaging Het
Olfr1269 A G 2: 90,118,839 V253A probably benign Het
Pcdha7 G A 18: 36,975,250 V443M probably damaging Het
Plekha1 G T 7: 130,909,601 R305I probably damaging Het
Psmb2 T A 4: 126,684,209 I60N probably damaging Het
Rad17 C A 13: 100,631,104 G330C probably damaging Het
Slc5a6 A G 5: 31,043,102 S80P probably damaging Het
Srgap2 T A 1: 131,300,390 probably null Het
Taf8 C A 17: 47,494,482 R164L possibly damaging Het
Tmem87a C A 2: 120,397,430 D79Y probably damaging Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Usf3 A G 16: 44,217,370 T738A probably benign Het
Vmn2r54 A C 7: 12,632,416 V197G probably benign Het
Zbtb40 G T 4: 136,987,331 P1049Q probably damaging Het
Zfp551 A T 7: 12,415,561 S640R possibly damaging Het
Zfp932 T A 5: 110,009,847 C470* probably null Het
Zkscan8 T C 13: 21,526,668 I91V probably damaging Het
Zmat4 T C 8: 23,748,492 V30A probably damaging Het
Other mutations in Tmtc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Tmtc4 APN 14 122925954 splice site probably benign
IGL01408:Tmtc4 APN 14 122925954 splice site probably benign
IGL01487:Tmtc4 APN 14 122926031 missense probably benign 0.25
IGL01694:Tmtc4 APN 14 122973212 missense possibly damaging 0.92
IGL01934:Tmtc4 APN 14 122927635 nonsense probably null
IGL02456:Tmtc4 APN 14 122925962 critical splice donor site probably null
IGL03116:Tmtc4 APN 14 122927632 missense probably benign 0.02
IGL03326:Tmtc4 APN 14 122945540 missense probably damaging 0.99
PIT4403001:Tmtc4 UTSW 14 122973229 missense probably benign 0.01
R0344:Tmtc4 UTSW 14 122978160 missense probably damaging 1.00
R0630:Tmtc4 UTSW 14 122926090 splice site probably benign
R0849:Tmtc4 UTSW 14 122945554 missense possibly damaging 0.62
R1129:Tmtc4 UTSW 14 122943153 critical splice donor site probably null
R1601:Tmtc4 UTSW 14 122944826 missense probably benign 0.01
R1835:Tmtc4 UTSW 14 122941988 critical splice acceptor site probably null
R1966:Tmtc4 UTSW 14 122927599 missense probably benign 0.31
R2024:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2025:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2026:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2027:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2256:Tmtc4 UTSW 14 122941408 missense probably benign 0.09
R2439:Tmtc4 UTSW 14 122971903 missense probably damaging 1.00
R3001:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3002:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3894:Tmtc4 UTSW 14 122921319 intron probably null
R4561:Tmtc4 UTSW 14 122963298 missense probably benign 0.21
R4926:Tmtc4 UTSW 14 122973206 missense probably damaging 1.00
R5000:Tmtc4 UTSW 14 122933331 missense possibly damaging 0.46
R5024:Tmtc4 UTSW 14 122941302 splice site probably null
R5104:Tmtc4 UTSW 14 122932845 missense probably damaging 0.99
R5200:Tmtc4 UTSW 14 122945557 missense probably benign 0.05
R5677:Tmtc4 UTSW 14 122950499 missense probably damaging 1.00
R5768:Tmtc4 UTSW 14 122933153 missense possibly damaging 0.91
R6467:Tmtc4 UTSW 14 122925979 missense possibly damaging 0.80
R7317:Tmtc4 UTSW 14 122978181 missense probably benign 0.00
R7516:Tmtc4 UTSW 14 122943323 missense possibly damaging 0.68
R7539:Tmtc4 UTSW 14 122978289 splice site probably null
R7584:Tmtc4 UTSW 14 122978151 missense probably benign 0.01
R7821:Tmtc4 UTSW 14 122971877 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTCGGCAGTGTATACAAGG -3'
(R):5'- CTTTTCTTAACATTCTGCCAGGAAC -3'

Sequencing Primer
(F):5'- CTTCGGCAGTGTATACAAGGAAATC -3'
(R):5'- GCCGCATGGATGAATTTG -3'
Posted On2016-10-24