Incidental Mutation 'R5537:Acsl3'
ID434854
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Nameacyl-CoA synthetase long-chain family member 3
Synonyms2610510B12Rik, Facl3, C85929
MMRRC Submission 043095-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R5537 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78657825-78707743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78706356 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 702 (R702C)
Ref Sequence ENSEMBL: ENSMUSP00000121695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000142704]
Predicted Effect probably damaging
Transcript: ENSMUST00000035779
AA Change: R702C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: R702C

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134566
AA Change: R550C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883
AA Change: R550C

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142704
AA Change: R702C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: R702C

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,955,485 I1123F probably damaging Het
Ank1 A G 8: 23,114,876 E1031G probably damaging Het
Ankle2 T C 5: 110,249,495 S536P probably damaging Het
Arfgef2 G T 2: 166,856,593 probably null Het
Bahd1 G T 2: 118,915,980 D27Y probably damaging Het
Brinp2 C T 1: 158,255,013 V246I probably damaging Het
Ccdc187 C A 2: 26,276,225 A731S probably benign Het
Cdc37l1 T A 19: 28,995,118 N70K probably damaging Het
Cdk5r1 A G 11: 80,477,999 Y164C probably damaging Het
Clrn3 A T 7: 135,514,062 H186Q probably benign Het
Col12a1 G A 9: 79,699,590 T517I probably damaging Het
Crhr1 T A 11: 104,163,856 N98K possibly damaging Het
Dst C T 1: 34,189,878 S2362L probably benign Het
Eapp G A 12: 54,692,059 T98I probably benign Het
Gm8394 A G 10: 85,314,049 noncoding transcript Het
Iqsec3 T C 6: 121,412,644 probably benign Het
Kctd12 A G 14: 102,982,277 V55A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lgr5 T C 10: 115,456,689 D432G probably benign Het
Mrgprx1 T A 7: 48,021,150 H283L probably benign Het
Nlrp4e T C 7: 23,320,489 F134L probably benign Het
Olfr1030 T A 2: 85,984,226 Y129N possibly damaging Het
Olfr1307 A T 2: 111,945,048 M136K probably damaging Het
Olfr394 T C 11: 73,887,697 K225R probably benign Het
Olfr902 T A 9: 38,449,242 Y123* probably null Het
Pfkp C A 13: 6,619,242 W235L probably damaging Het
Prom1 C T 5: 44,000,776 probably null Het
Rab14 A T 2: 35,192,637 F12L possibly damaging Het
Rnf40 T A 7: 127,596,089 I429N probably benign Het
S100pbp G A 4: 129,182,188 P115S probably benign Het
Scarf1 G A 11: 75,525,531 A600T probably damaging Het
Slc6a5 T C 7: 49,959,311 F755L probably benign Het
Slc7a2 A T 8: 40,913,986 I510F probably benign Het
Spag16 T C 1: 69,827,016 S5P probably benign Het
Tex15 A G 8: 33,571,613 Y631C probably damaging Het
Tmem182 A T 1: 40,854,909 I195F probably benign Het
Tox A G 4: 6,697,510 L431P probably damaging Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Tsg101 T C 7: 46,891,128 K294E probably benign Het
Tubb2a C A 13: 34,075,451 V119L probably benign Het
Vps37d C T 5: 135,074,402 E129K possibly damaging Het
Zfp974 TAATCTGTCTCCAAATCTG TAATCTG 7: 27,912,246 probably benign Het
Zpld1 A G 16: 55,233,640 V263A possibly damaging Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78699759 missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78699153 missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78699170 critical splice donor site probably null
R0601:Acsl3 UTSW 1 78696179 missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78701287 missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78688282 missense probably benign
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1697:Acsl3 UTSW 1 78705397 splice site probably benign
R2083:Acsl3 UTSW 1 78699811 missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78681961 missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78699140 missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78699110 missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78705368 missense probably benign 0.00
R2964:Acsl3 UTSW 1 78694294 missense probably benign 0.01
R3403:Acsl3 UTSW 1 78696122 missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78690346 missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78688286 missense probably benign
R6239:Acsl3 UTSW 1 78696465 missense probably benign 0.00
R6376:Acsl3 UTSW 1 78696465 missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78681922 missense probably benign 0.03
R7031:Acsl3 UTSW 1 78688283 missense probably benign
R7282:Acsl3 UTSW 1 78681992 missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78688236 critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7974:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7998:Acsl3 UTSW 1 78694271 missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78681894 missense probably damaging 1.00
X0025:Acsl3 UTSW 1 78692202 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCGTTTGCTGAGAACTTTGAC -3'
(R):5'- ACAGACACGAGTTTGCTGTC -3'

Sequencing Primer
(F):5'- AGAACTTTGACTTCATCTCTTGTGG -3'
(R):5'- CCTGTCAGTTAAAAATGGTGACG -3'
Posted On2016-10-24