Incidental Mutation 'R5537:Prom1'
ID434869
Institutional Source Beutler Lab
Gene Symbol Prom1
Ensembl Gene ENSMUSG00000029086
Gene Nameprominin 1
Synonyms4932416E19Rik, Prom, AC133, CD133, Prom-1
MMRRC Submission 043095-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R5537 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43993620-44102032 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 44000776 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030973] [ENSMUST00000074113] [ENSMUST00000087441] [ENSMUST00000087442] [ENSMUST00000165909] [ENSMUST00000171543] [ENSMUST00000177946] [ENSMUST00000179059] [ENSMUST00000197706] [ENSMUST00000197750]
Predicted Effect probably benign
Transcript: ENSMUST00000030973
SMART Domains Protein: ENSMUSP00000030973
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 326 1.5e-113 PFAM
Pfam:Prominin 322 798 4.6e-188 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074113
SMART Domains Protein: ENSMUSP00000073751
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
Pfam:Prominin 18 822 2e-294 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087441
SMART Domains Protein: ENSMUSP00000084707
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087442
SMART Domains Protein: ENSMUSP00000084709
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165909
SMART Domains Protein: ENSMUSP00000129909
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171543
SMART Domains Protein: ENSMUSP00000128978
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177946
SMART Domains Protein: ENSMUSP00000136483
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179059
SMART Domains Protein: ENSMUSP00000137557
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196378
Predicted Effect probably benign
Transcript: ENSMUST00000197706
SMART Domains Protein: ENSMUSP00000142632
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 321 6.6e-110 PFAM
Pfam:Prominin 317 793 6.8e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197750
SMART Domains Protein: ENSMUSP00000142375
Gene: ENSMUSG00000029086

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retina morphology, vasculature, and electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,955,485 I1123F probably damaging Het
Acsl3 C T 1: 78,706,356 R702C probably damaging Het
Ank1 A G 8: 23,114,876 E1031G probably damaging Het
Ankle2 T C 5: 110,249,495 S536P probably damaging Het
Arfgef2 G T 2: 166,856,593 probably null Het
Bahd1 G T 2: 118,915,980 D27Y probably damaging Het
Brinp2 C T 1: 158,255,013 V246I probably damaging Het
Ccdc187 C A 2: 26,276,225 A731S probably benign Het
Cdc37l1 T A 19: 28,995,118 N70K probably damaging Het
Cdk5r1 A G 11: 80,477,999 Y164C probably damaging Het
Clrn3 A T 7: 135,514,062 H186Q probably benign Het
Col12a1 G A 9: 79,699,590 T517I probably damaging Het
Crhr1 T A 11: 104,163,856 N98K possibly damaging Het
Dst C T 1: 34,189,878 S2362L probably benign Het
Eapp G A 12: 54,692,059 T98I probably benign Het
Gm8394 A G 10: 85,314,049 noncoding transcript Het
Iqsec3 T C 6: 121,412,644 probably benign Het
Kctd12 A G 14: 102,982,277 V55A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lgr5 T C 10: 115,456,689 D432G probably benign Het
Mrgprx1 T A 7: 48,021,150 H283L probably benign Het
Nlrp4e T C 7: 23,320,489 F134L probably benign Het
Olfr1030 T A 2: 85,984,226 Y129N possibly damaging Het
Olfr1307 A T 2: 111,945,048 M136K probably damaging Het
Olfr394 T C 11: 73,887,697 K225R probably benign Het
Olfr902 T A 9: 38,449,242 Y123* probably null Het
Pfkp C A 13: 6,619,242 W235L probably damaging Het
Rab14 A T 2: 35,192,637 F12L possibly damaging Het
Rnf40 T A 7: 127,596,089 I429N probably benign Het
S100pbp G A 4: 129,182,188 P115S probably benign Het
Scarf1 G A 11: 75,525,531 A600T probably damaging Het
Slc6a5 T C 7: 49,959,311 F755L probably benign Het
Slc7a2 A T 8: 40,913,986 I510F probably benign Het
Spag16 T C 1: 69,827,016 S5P probably benign Het
Tex15 A G 8: 33,571,613 Y631C probably damaging Het
Tmem182 A T 1: 40,854,909 I195F probably benign Het
Tox A G 4: 6,697,510 L431P probably damaging Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Tsg101 T C 7: 46,891,128 K294E probably benign Het
Tubb2a C A 13: 34,075,451 V119L probably benign Het
Vps37d C T 5: 135,074,402 E129K possibly damaging Het
Zfp974 TAATCTGTCTCCAAATCTG TAATCTG 7: 27,912,246 probably benign Het
Zpld1 A G 16: 55,233,640 V263A possibly damaging Het
Other mutations in Prom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Prom1 APN 5 44055937 missense probably damaging 1.00
IGL00392:Prom1 APN 5 44007021 critical splice donor site probably null
IGL00771:Prom1 APN 5 44029776 splice site probably benign
IGL00841:Prom1 APN 5 44063116 splice site probably benign
IGL01780:Prom1 APN 5 44029604 splice site probably benign
IGL01991:Prom1 APN 5 44047506 missense probably benign 0.13
IGL02220:Prom1 APN 5 44014789 missense probably damaging 1.00
IGL02350:Prom1 APN 5 44029604 splice site probably benign
IGL02357:Prom1 APN 5 44029604 splice site probably benign
IGL02420:Prom1 APN 5 44063154 missense probably benign 0.15
IGL02468:Prom1 APN 5 44029698 missense probably benign 0.01
IGL02633:Prom1 APN 5 44014775 missense probably benign 0.20
IGL02871:Prom1 APN 5 44029676 missense probably damaging 1.00
IGL02967:Prom1 APN 5 44044398 missense probably damaging 1.00
IGL03033:Prom1 APN 5 44006160 splice site probably null
IGL03072:Prom1 APN 5 44058662 intron probably benign
IGL03149:Prom1 APN 5 44029734 missense probably damaging 0.99
IGL03277:Prom1 APN 5 44032971 nonsense probably null
R1018:Prom1 UTSW 5 44029714 missense probably benign 0.02
R1456:Prom1 UTSW 5 44037623 missense probably damaging 0.96
R1458:Prom1 UTSW 5 44032932 splice site probably benign
R1536:Prom1 UTSW 5 44018353 missense probably benign 0.39
R1747:Prom1 UTSW 5 44007031 missense probably benign 0.03
R1772:Prom1 UTSW 5 44011224 missense probably benign 0.00
R2020:Prom1 UTSW 5 44011253 splice site probably benign
R2022:Prom1 UTSW 5 44029726 missense probably benign 0.18
R2091:Prom1 UTSW 5 44014086 splice site probably benign
R2163:Prom1 UTSW 5 44014163 missense possibly damaging 0.72
R2177:Prom1 UTSW 5 44026739 missense possibly damaging 0.67
R3015:Prom1 UTSW 5 44034391 missense probably damaging 1.00
R3022:Prom1 UTSW 5 44047574 missense probably damaging 1.00
R4824:Prom1 UTSW 5 44034390 missense probably damaging 0.98
R4909:Prom1 UTSW 5 44045552 missense probably benign 0.00
R4999:Prom1 UTSW 5 44037534 missense probably benign 0.00
R5082:Prom1 UTSW 5 44000832 unclassified probably null
R5351:Prom1 UTSW 5 44044355 missense probably damaging 1.00
R5401:Prom1 UTSW 5 44000805 missense probably damaging 0.99
R5440:Prom1 UTSW 5 44058646 missense probably benign
R5529:Prom1 UTSW 5 44026768 missense probably damaging 1.00
R5669:Prom1 UTSW 5 44012943 missense possibly damaging 0.64
R5723:Prom1 UTSW 5 44014894 missense probably benign 0.30
R5778:Prom1 UTSW 5 44007047 missense probably benign 0.13
R5924:Prom1 UTSW 5 44004963 missense probably benign 0.02
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6145:Prom1 UTSW 5 44029649 missense probably benign 0.05
R6374:Prom1 UTSW 5 44055983 missense probably damaging 1.00
R6542:Prom1 UTSW 5 44037509 missense possibly damaging 0.84
R6645:Prom1 UTSW 5 44047514 missense probably damaging 0.98
R7158:Prom1 UTSW 5 44012913 missense probably damaging 1.00
R7233:Prom1 UTSW 5 44037474 missense possibly damaging 0.90
R7244:Prom1 UTSW 5 44020900 missense probably benign 0.03
R7339:Prom1 UTSW 5 44101653 unclassified probably benign
R7365:Prom1 UTSW 5 44020831 missense probably damaging 1.00
R7573:Prom1 UTSW 5 44055930 missense probably damaging 0.99
R7592:Prom1 UTSW 5 44063127 missense probably damaging 0.96
R7809:Prom1 UTSW 5 44020867 missense probably benign 0.10
Z1177:Prom1 UTSW 5 44014838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGGAAGGCTATGCAGAG -3'
(R):5'- CCCTCTGTGGTTTTGAAAGAGG -3'

Sequencing Primer
(F):5'- TGCAGAGCATGGCTAGGGC -3'
(R):5'- TTGCAGACTTAGCAATTCGC -3'
Posted On2016-10-24