Incidental Mutation 'R5537:Nlrp4e'
ID434873
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission 043095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5537 (G1)
Quality Score149
Status Not validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23320489 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 134 (F134L)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: F134L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: F134L

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,955,485 I1123F probably damaging Het
Acsl3 C T 1: 78,706,356 R702C probably damaging Het
Ank1 A G 8: 23,114,876 E1031G probably damaging Het
Ankle2 T C 5: 110,249,495 S536P probably damaging Het
Arfgef2 G T 2: 166,856,593 probably null Het
Bahd1 G T 2: 118,915,980 D27Y probably damaging Het
Brinp2 C T 1: 158,255,013 V246I probably damaging Het
Ccdc187 C A 2: 26,276,225 A731S probably benign Het
Cdc37l1 T A 19: 28,995,118 N70K probably damaging Het
Cdk5r1 A G 11: 80,477,999 Y164C probably damaging Het
Clrn3 A T 7: 135,514,062 H186Q probably benign Het
Col12a1 G A 9: 79,699,590 T517I probably damaging Het
Crhr1 T A 11: 104,163,856 N98K possibly damaging Het
Dst C T 1: 34,189,878 S2362L probably benign Het
Eapp G A 12: 54,692,059 T98I probably benign Het
Gm8394 A G 10: 85,314,049 noncoding transcript Het
Iqsec3 T C 6: 121,412,644 probably benign Het
Kctd12 A G 14: 102,982,277 V55A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lgr5 T C 10: 115,456,689 D432G probably benign Het
Mrgprx1 T A 7: 48,021,150 H283L probably benign Het
Olfr1030 T A 2: 85,984,226 Y129N possibly damaging Het
Olfr1307 A T 2: 111,945,048 M136K probably damaging Het
Olfr394 T C 11: 73,887,697 K225R probably benign Het
Olfr902 T A 9: 38,449,242 Y123* probably null Het
Pfkp C A 13: 6,619,242 W235L probably damaging Het
Prom1 C T 5: 44,000,776 probably null Het
Rab14 A T 2: 35,192,637 F12L possibly damaging Het
Rnf40 T A 7: 127,596,089 I429N probably benign Het
S100pbp G A 4: 129,182,188 P115S probably benign Het
Scarf1 G A 11: 75,525,531 A600T probably damaging Het
Slc6a5 T C 7: 49,959,311 F755L probably benign Het
Slc7a2 A T 8: 40,913,986 I510F probably benign Het
Spag16 T C 1: 69,827,016 S5P probably benign Het
Tex15 A G 8: 33,571,613 Y631C probably damaging Het
Tmem182 A T 1: 40,854,909 I195F probably benign Het
Tox A G 4: 6,697,510 L431P probably damaging Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Tsg101 T C 7: 46,891,128 K294E probably benign Het
Tubb2a C A 13: 34,075,451 V119L probably benign Het
Vps37d C T 5: 135,074,402 E129K possibly damaging Het
Zfp974 TAATCTGTCTCCAAATCTG TAATCTG 7: 27,912,246 probably benign Het
Zpld1 A G 16: 55,233,640 V263A possibly damaging Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGCTCTCTGTGGGTGAATG -3'
(R):5'- ATCAATTCTGCCAGGCTTGCTC -3'

Sequencing Primer
(F):5'- CTCTGTGGGTGAATGTTTAACTTAAC -3'
(R):5'- CTTCTTCACATCTTGACAGCAGAAG -3'
Posted On2016-10-24