Incidental Mutation 'R5537:Olfr902'
ID434882
Institutional Source Beutler Lab
Gene Symbol Olfr902
Ensembl Gene ENSMUSG00000049334
Gene Nameolfactory receptor 902
SynonymsGA_x6K02T2PVTD-32141623-32142552, MOR169-1
MMRRC Submission 043095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5537 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38447652-38450576 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38449242 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 123 (Y123*)
Ref Sequence ENSEMBL: ENSMUSP00000151061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050733] [ENSMUST00000213105]
Predicted Effect probably null
Transcript: ENSMUST00000050733
AA Change: Y123*
SMART Domains Protein: ENSMUSP00000055975
Gene: ENSMUSG00000049334
AA Change: Y123*

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-48 PFAM
Pfam:7tm_1 41 289 1.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213105
AA Change: Y123*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,955,485 I1123F probably damaging Het
Acsl3 C T 1: 78,706,356 R702C probably damaging Het
Ank1 A G 8: 23,114,876 E1031G probably damaging Het
Ankle2 T C 5: 110,249,495 S536P probably damaging Het
Arfgef2 G T 2: 166,856,593 probably null Het
Bahd1 G T 2: 118,915,980 D27Y probably damaging Het
Brinp2 C T 1: 158,255,013 V246I probably damaging Het
Ccdc187 C A 2: 26,276,225 A731S probably benign Het
Cdc37l1 T A 19: 28,995,118 N70K probably damaging Het
Cdk5r1 A G 11: 80,477,999 Y164C probably damaging Het
Clrn3 A T 7: 135,514,062 H186Q probably benign Het
Col12a1 G A 9: 79,699,590 T517I probably damaging Het
Crhr1 T A 11: 104,163,856 N98K possibly damaging Het
Dst C T 1: 34,189,878 S2362L probably benign Het
Eapp G A 12: 54,692,059 T98I probably benign Het
Gm8394 A G 10: 85,314,049 noncoding transcript Het
Iqsec3 T C 6: 121,412,644 probably benign Het
Kctd12 A G 14: 102,982,277 V55A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lgr5 T C 10: 115,456,689 D432G probably benign Het
Mrgprx1 T A 7: 48,021,150 H283L probably benign Het
Nlrp4e T C 7: 23,320,489 F134L probably benign Het
Olfr1030 T A 2: 85,984,226 Y129N possibly damaging Het
Olfr1307 A T 2: 111,945,048 M136K probably damaging Het
Olfr394 T C 11: 73,887,697 K225R probably benign Het
Pfkp C A 13: 6,619,242 W235L probably damaging Het
Prom1 C T 5: 44,000,776 probably null Het
Rab14 A T 2: 35,192,637 F12L possibly damaging Het
Rnf40 T A 7: 127,596,089 I429N probably benign Het
S100pbp G A 4: 129,182,188 P115S probably benign Het
Scarf1 G A 11: 75,525,531 A600T probably damaging Het
Slc6a5 T C 7: 49,959,311 F755L probably benign Het
Slc7a2 A T 8: 40,913,986 I510F probably benign Het
Spag16 T C 1: 69,827,016 S5P probably benign Het
Tex15 A G 8: 33,571,613 Y631C probably damaging Het
Tmem182 A T 1: 40,854,909 I195F probably benign Het
Tox A G 4: 6,697,510 L431P probably damaging Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Tsg101 T C 7: 46,891,128 K294E probably benign Het
Tubb2a C A 13: 34,075,451 V119L probably benign Het
Vps37d C T 5: 135,074,402 E129K possibly damaging Het
Zfp974 TAATCTGTCTCCAAATCTG TAATCTG 7: 27,912,246 probably benign Het
Zpld1 A G 16: 55,233,640 V263A possibly damaging Het
Other mutations in Olfr902
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01738:Olfr902 APN 9 38449646 missense probably damaging 0.97
IGL02149:Olfr902 APN 9 38449397 missense probably damaging 0.97
IGL02869:Olfr902 APN 9 38449193 missense possibly damaging 0.75
IGL02945:Olfr902 APN 9 38449516 missense probably benign 0.00
IGL03269:Olfr902 APN 9 38448901 missense probably benign 0.13
R1955:Olfr902 UTSW 9 38449688 missense probably benign 0.13
R2182:Olfr902 UTSW 9 38449124 missense probably benign 0.21
R2864:Olfr902 UTSW 9 38449388 missense possibly damaging 0.89
R4423:Olfr902 UTSW 9 38449366 missense probably benign 0.03
R4938:Olfr902 UTSW 9 38449383 missense probably benign 0.10
R6645:Olfr902 UTSW 9 38448923 missense probably damaging 1.00
R6861:Olfr902 UTSW 9 38449435 missense probably damaging 1.00
R6951:Olfr902 UTSW 9 38448938 missense probably benign 0.00
R7568:Olfr902 UTSW 9 38449646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCATTGGGAAATTTGGG -3'
(R):5'- GATGTCACAGAAGTAGTGGTTGATG -3'

Sequencing Primer
(F):5'- TTGCTAAATTCACATCTTCACACAC -3'
(R):5'- CACAGAAGTAGTGGTTGATGTTTCC -3'
Posted On2016-10-24