Incidental Mutation 'R5538:Slc19a3'
ID434900
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission 043096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5538 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83022561 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 245 (N245I)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045560
AA Change: N245I

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: N245I

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect possibly damaging
Transcript: ENSMUST00000164473
AA Change: N245I

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: N245I

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik T A 18: 40,257,266 Y97* probably null Het
4930467E23Rik A C 8: 19,749,414 probably null Het
Adgrv1 C A 13: 81,433,689 R4745S probably benign Het
Ank3 A G 10: 69,987,427 E642G probably damaging Het
Arhgap11a G T 2: 113,837,530 D375E probably benign Het
Arl8b C A 6: 108,783,336 L28M probably damaging Het
Bbs2 G A 8: 94,089,763 T157M probably damaging Het
C2cd3 T A 7: 100,455,493 probably null Het
C6 T A 15: 4,814,829 I911N possibly damaging Het
Cc2d2a T C 5: 43,695,176 I365T possibly damaging Het
Cd46 T G 1: 195,068,170 probably null Het
Ceacam3 A T 7: 17,158,421 D363V probably damaging Het
Cep63 A T 9: 102,588,793 L678* probably null Het
Clasrp A C 7: 19,584,782 probably benign Het
Clk2 T A 3: 89,175,655 Y412N probably damaging Het
Col24a1 C T 3: 145,293,121 A5V probably damaging Het
Cox16 T C 12: 81,484,929 N13D possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx32 A T 7: 133,723,217 M437K probably benign Het
Dnm2 T C 9: 21,505,627 F819L probably benign Het
Dpysl4 A G 7: 139,091,990 T85A probably benign Het
Dspp A T 5: 104,175,230 K80* probably null Het
Dync2h1 T C 9: 7,168,630 probably benign Het
Ern1 A G 11: 106,421,901 V218A possibly damaging Het
Fbn2 G A 18: 58,071,901 R1157C probably benign Het
Fez1 T A 9: 36,868,876 I323N probably damaging Het
Fmo9 T A 1: 166,673,629 T199S probably benign Het
Fry T A 5: 150,495,848 L915Q probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gnpda2 A T 5: 69,578,051 H230Q probably damaging Het
Gramd1c T A 16: 43,982,092 N652I probably damaging Het
H2-Bl T A 17: 36,081,286 H178L probably benign Het
Hells T A 19: 38,953,652 F462Y probably benign Het
Htr7 A G 19: 35,969,835 F260L probably benign Het
Itsn1 C A 16: 91,784,102 A23D probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Kif20b A T 19: 34,952,964 K25* probably null Het
Klf2 T C 8: 72,319,472 L40P probably damaging Het
Kmt2a A G 9: 44,820,342 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lonrf1 T A 8: 36,223,024 probably null Het
Lrp1b A T 2: 40,697,474 I154K unknown Het
Mybpc1 T A 10: 88,546,029 I600L possibly damaging Het
Npnt T C 3: 132,904,963 N285S probably damaging Het
Olfr1255 T A 2: 89,816,620 F92Y probably damaging Het
Olfr429 T C 1: 174,089,978 *313R probably null Het
Olfr572 A G 7: 102,928,521 T298A probably damaging Het
Olfr816 T A 10: 129,912,002 Y92F probably benign Het
Pcnx T C 12: 81,860,409 V13A probably damaging Het
Pddc1 A G 7: 141,406,845 probably benign Het
Phkb G A 8: 85,922,127 V191I possibly damaging Het
Pnpla6 A G 8: 3,531,508 M594V probably benign Het
Prkdc A G 16: 15,651,469 E146G probably damaging Het
Ror1 T C 4: 100,441,011 M527T probably benign Het
Scnm1 A G 3: 95,129,755 probably benign Het
Skint11 A T 4: 114,231,762 N251I probably damaging Het
Slc1a3 A T 15: 8,645,704 D272E probably damaging Het
Smok2b T A 17: 13,235,553 V200D possibly damaging Het
Sspo T C 6: 48,452,178 Y417H probably damaging Het
Stk11ip C A 1: 75,528,335 S388R probably damaging Het
Svep1 T C 4: 58,049,282 probably null Het
Sytl2 A G 7: 90,388,906 I525V probably benign Het
Tie1 T C 4: 118,486,193 N158D probably benign Het
Tle2 T C 10: 81,580,584 L180P probably damaging Het
Txlnb T C 10: 17,838,909 L363P probably damaging Het
Upk3b C G 5: 136,044,036 A258G probably benign Het
Usp32 A T 11: 85,017,786 D1031E possibly damaging Het
Vmn2r116 C T 17: 23,401,067 L592F probably benign Het
Zfp607b A G 7: 27,702,869 H250R probably damaging Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
tag UTSW 1 83026260 missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83022495 missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 83014812 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCTTGTGTTCCCATAGGAC -3'
(R):5'- GACGAACCTGCCATACTCTAG -3'

Sequencing Primer
(F):5'- TGTGTTCCCATAGGACTTGAAC -3'
(R):5'- ATATATCCTTGGCCTGTGTCTCTGTG -3'
Posted On2016-10-24