Incidental Mutation 'R0189:Rnf17'
ID43491
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 038450-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R0189 (G1)
Quality Score109
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56482193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 967 (S967G)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793]
Predicted Effect probably null
Transcript: ENSMUST00000095793
AA Change: S967G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: S967G

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225621
Meta Mutation Damage Score 0.1541 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,096,947 V207A possibly damaging Het
Abca9 A T 11: 110,108,653 W1459R probably damaging Het
Abca9 A T 11: 110,141,662 probably benign Het
Adam25 T A 8: 40,755,430 C578S probably damaging Het
Adam32 T A 8: 24,922,337 probably null Het
Add1 T C 5: 34,616,648 V67A probably benign Het
Aggf1 A T 13: 95,356,480 probably benign Het
Ahcyl2 A T 6: 29,891,243 I449F probably benign Het
Ak6 A G 13: 100,655,142 Y31C probably damaging Het
Akap6 T C 12: 53,141,254 V1817A probably benign Het
Arhgef17 G T 7: 100,928,850 P964T probably damaging Het
Atxn7l3b A T 10: 112,928,580 L48Q possibly damaging Het
Bbs10 T G 10: 111,301,065 S680A probably damaging Het
Bcl7c G A 7: 127,705,764 T164I probably damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Ccdc110 T A 8: 45,935,082 D25E probably damaging Het
Ccdc83 T A 7: 90,226,683 T327S possibly damaging Het
Coro1b T C 19: 4,153,251 Y364H probably damaging Het
Cstf3 A G 2: 104,652,446 D313G probably damaging Het
Dlgap5 T A 14: 47,412,975 probably null Het
Dusp3 A T 11: 101,981,721 I83N probably damaging Het
Eea1 A T 10: 95,995,582 K178N possibly damaging Het
Efr3b T A 12: 3,982,925 D144V probably damaging Het
Gm1110 T A 9: 26,883,218 E504V probably null Het
Got2 T C 8: 95,888,253 H18R probably benign Het
Gprc5b T C 7: 118,983,633 M338V probably benign Het
Has2 A T 15: 56,668,435 F295I probably damaging Het
Hcn3 T C 3: 89,148,800 D519G probably damaging Het
Ino80 T A 2: 119,379,679 D1377V probably benign Het
Iqsec3 A T 6: 121,413,562 probably benign Het
Kif3c T A 12: 3,365,989 S3R probably benign Het
Krt17 A G 11: 100,260,619 I116T possibly damaging Het
Lrba T C 3: 86,368,509 V1728A probably damaging Het
Map3k6 G T 4: 133,246,941 V550L possibly damaging Het
Mcph1 T C 8: 18,788,471 V803A probably damaging Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Msh5 T C 17: 35,029,654 E772G probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndfip2 T C 14: 105,304,740 L308P probably damaging Het
Ndufb10 T C 17: 24,724,235 T34A probably benign Het
Nipal3 A T 4: 135,468,518 I258N possibly damaging Het
Nup54 A G 5: 92,422,564 V328A probably damaging Het
Olfr1410 T C 1: 92,607,893 F19L probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr615 G T 7: 103,561,082 V202F probably benign Het
Olfr763 T A 10: 129,011,322 F12L possibly damaging Het
Olfr923 T A 9: 38,827,815 Y41* probably null Het
Oprm1 T C 10: 6,789,071 V66A possibly damaging Het
Peg12 G A 7: 62,463,548 T267I unknown Het
Phf20 A G 2: 156,303,141 S890G probably benign Het
Plk2 C T 13: 110,399,463 T567M probably damaging Het
Pola2 A T 19: 5,942,342 probably benign Het
Ppp1r12b A G 1: 134,865,776 probably null Het
Prickle1 A T 15: 93,503,019 L528* probably null Het
Prpf6 T A 2: 181,655,457 N903K probably benign Het
Ptprc G A 1: 138,082,715 A601V probably benign Het
Ranbp1 A T 16: 18,241,743 probably null Het
Rapgef6 C T 11: 54,691,249 S1334L probably benign Het
Rgs2 T C 1: 144,002,284 probably null Het
Ripk2 A T 4: 16,129,125 probably null Het
Rock2 T A 12: 16,959,516 probably benign Het
Rpusd3 C T 6: 113,415,553 probably null Het
Scgb1b20 G T 7: 33,373,510 V48L probably benign Het
Sec16a T A 2: 26,424,414 probably null Het
Serpina5 T A 12: 104,103,330 L267H probably damaging Het
Slc12a3 C T 8: 94,356,358 H875Y probably benign Het
Slc45a4 A G 15: 73,581,914 S745P probably benign Het
Sucla2 T C 14: 73,592,648 V375A probably damaging Het
Sun2 C A 15: 79,737,076 V213F probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 C T 6: 7,562,424 R129C probably damaging Het
Taf6 T C 5: 138,182,713 E202G probably benign Het
Tex21 T A 12: 76,239,533 H64L probably benign Het
Tgs1 A G 4: 3,593,620 S503G probably benign Het
Tmem184c C T 8: 77,597,812 V350I possibly damaging Het
Tnks1bp1 A G 2: 85,070,929 S960G possibly damaging Het
Trbc2 T C 6: 41,548,149 probably benign Het
Tsta3 C A 15: 75,926,978 D127Y probably damaging Het
Tubgcp2 A T 7: 140,001,605 probably benign Het
Vmn1r39 T A 6: 66,805,197 T46S probably benign Het
Vmn1r61 T C 7: 5,610,700 H205R probably benign Het
Zdhhc14 T C 17: 5,725,264 S264P possibly damaging Het
Zfp101 T A 17: 33,382,239 H181L possibly damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CAGCCAAAGGTTGGTAAAGTCTGAATTG -3'
(R):5'- ACACTAAATCCAGGCTGACAGGAGTAAG -3'

Sequencing Primer
(F):5'- CTCTAAAAAGCATCTTGAAGTATGGG -3'
(R):5'- ctgacaggagtaaggtgcttag -3'
Posted On2013-05-24