Mutagenetix > Incidental Mutations

Incidental Mutation 'R5538:Ror1'

434912

Institutional Source

Beutler Lab

Gene Symbol

Ror1

Ensembl Gene

ENSMUSG00000035305

Gene Name

receptor tyrosine kinase-like orphan receptor 1

Synonyms

2810404D04Rik, Ntrkr1

MMRRC Submission

043096-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5538 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100095791-100444765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100441011 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 527 (M527T)

Ref Sequence

ENSEMBL: ENSMUSP00000048171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039630]

Predicted Effect

probably benign
Transcript: ENSMUST00000039630
AA Change: M527T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: M527T

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	70	138	8.37e-15	SMART
Pfam:Fz	170	290	4.9e-13	PFAM
KR	311	393	7.57e-47	SMART
transmembrane domain	404	426	N/A	INTRINSIC
TyrKc	473	746	2.46e-137	SMART
low complexity region	753	762	N/A	INTRINSIC
low complexity region	817	828	N/A	INTRINSIC
low complexity region	849	864	N/A	INTRINSIC

Meta Mutation Damage Score

0.1825

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

94% (73/78)

MGI Phenotype

FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900055J20Rik	T	A	18: 40,257,266	Y97*	probably null	Het
4930467E23Rik	A	C	8: 19,749,414		probably null	Het
Adgrv1	C	A	13: 81,433,689	R4745S	probably benign	Het
Ank3	A	G	10: 69,987,427	E642G	probably damaging	Het
Arhgap11a	G	T	2: 113,837,530	D375E	probably benign	Het
Arl8b	C	A	6: 108,783,336	L28M	probably damaging	Het
Bbs2	G	A	8: 94,089,763	T157M	probably damaging	Het
C2cd3	T	A	7: 100,455,493		probably null	Het
C6	T	A	15: 4,814,829	I911N	possibly damaging	Het
Cc2d2a	T	C	5: 43,695,176	I365T	possibly damaging	Het
Cd46	T	G	1: 195,068,170		probably null	Het
Ceacam3	A	T	7: 17,158,421	D363V	probably damaging	Het
Cep63	A	T	9: 102,588,793	L678*	probably null	Het
Clasrp	A	C	7: 19,584,782		probably benign	Het
Clk2	T	A	3: 89,175,655	Y412N	probably damaging	Het
Col24a1	C	T	3: 145,293,121	A5V	probably damaging	Het
Cox16	T	C	12: 81,484,929	N13D	possibly damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dhx32	A	T	7: 133,723,217	M437K	probably benign	Het
Dnm2	T	C	9: 21,505,627	F819L	probably benign	Het
Dpysl4	A	G	7: 139,091,990	T85A	probably benign	Het
Dspp	A	T	5: 104,175,230	K80*	probably null	Het
Dync2h1	T	C	9: 7,168,630		probably benign	Het
Ern1	A	G	11: 106,421,901	V218A	possibly damaging	Het
Fbn2	G	A	18: 58,071,901	R1157C	probably benign	Het
Fez1	T	A	9: 36,868,876	I323N	probably damaging	Het
Fmo9	T	A	1: 166,673,629	T199S	probably benign	Het
Fry	T	A	5: 150,495,848	L915Q	probably damaging	Het
Gm10719	T	C	9: 3,018,962	L69S	probably benign	Het
Gnpda2	A	T	5: 69,578,051	H230Q	probably damaging	Het
Gramd1c	T	A	16: 43,982,092	N652I	probably damaging	Het
H2-Bl	T	A	17: 36,081,286	H178L	probably benign	Het
Hells	T	A	19: 38,953,652	F462Y	probably benign	Het
Htr7	A	G	19: 35,969,835	F260L	probably benign	Het
Itsn1	C	A	16: 91,784,102	A23D	probably damaging	Het
Jak3	A	G	8: 71,678,773	D94G	probably benign	Het
Kif20b	A	T	19: 34,952,964	K25*	probably null	Het
Klf2	T	C	8: 72,319,472	L40P	probably damaging	Het
Kmt2a	A	G	9: 44,820,342		probably benign	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Lonrf1	T	A	8: 36,223,024		probably null	Het
Lrp1b	A	T	2: 40,697,474	I154K	unknown	Het
Mybpc1	T	A	10: 88,546,029	I600L	possibly damaging	Het
Npnt	T	C	3: 132,904,963	N285S	probably damaging	Het
Olfr1255	T	A	2: 89,816,620	F92Y	probably damaging	Het
Olfr429	T	C	1: 174,089,978	*313R	probably null	Het
Olfr572	A	G	7: 102,928,521	T298A	probably damaging	Het
Olfr816	T	A	10: 129,912,002	Y92F	probably benign	Het
Pcnx	T	C	12: 81,860,409	V13A	probably damaging	Het
Pddc1	A	G	7: 141,406,845		probably benign	Het
Phkb	G	A	8: 85,922,127	V191I	possibly damaging	Het
Pnpla6	A	G	8: 3,531,508	M594V	probably benign	Het
Prkdc	A	G	16: 15,651,469	E146G	probably damaging	Het
Scnm1	A	G	3: 95,129,755		probably benign	Het
Skint11	A	T	4: 114,231,762	N251I	probably damaging	Het
Slc19a3	T	A	1: 83,022,561	N245I	possibly damaging	Het
Slc1a3	A	T	15: 8,645,704	D272E	probably damaging	Het
Smok2b	T	A	17: 13,235,553	V200D	possibly damaging	Het
Sspo	T	C	6: 48,452,178	Y417H	probably damaging	Het
Stk11ip	C	A	1: 75,528,335	S388R	probably damaging	Het
Svep1	T	C	4: 58,049,282		probably null	Het
Sytl2	A	G	7: 90,388,906	I525V	probably benign	Het
Tie1	T	C	4: 118,486,193	N158D	probably benign	Het
Tle2	T	C	10: 81,580,584	L180P	probably damaging	Het
Txlnb	T	C	10: 17,838,909	L363P	probably damaging	Het
Upk3b	C	G	5: 136,044,036	A258G	probably benign	Het
Usp32	A	T	11: 85,017,786	D1031E	possibly damaging	Het
Vmn2r116	C	T	17: 23,401,067	L592F	probably benign	Het
Zfp607b	A	G	7: 27,702,869	H250R	probably damaging	Het

Other mutations in Ror1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Ror1	APN	4	100333743	missense	probably damaging	1.00
IGL00939:Ror1	APN	4	100441226	missense	probably benign	0.01
IGL01408:Ror1	APN	4	100333787	missense	probably damaging	1.00
IGL01678:Ror1	APN	4	100425968	missense	possibly damaging	0.68
IGL01700:Ror1	APN	4	100409771	missense	probably damaging	1.00
IGL01985:Ror1	APN	4	100425964	missense	possibly damaging	0.94
IGL02002:Ror1	APN	4	100441184	missense	probably damaging	1.00
IGL02634:Ror1	APN	4	100426110	missense	probably benign	0.00
IGL02995:Ror1	APN	4	100334525	splice site	probably benign
IGL03033:Ror1	APN	4	100411895	missense	possibly damaging	0.67
IGL03207:Ror1	APN	4	100407945	splice site	probably null
F5770:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
R0256:Ror1	UTSW	4	100409745	missense	probably benign	0.20
R0417:Ror1	UTSW	4	100412000	missense	possibly damaging	0.94
R0525:Ror1	UTSW	4	100441520	missense	probably damaging	1.00
R1034:Ror1	UTSW	4	100333620	nonsense	probably null
R1278:Ror1	UTSW	4	100441878	missense	possibly damaging	0.69
R1368:Ror1	UTSW	4	100441137	missense	possibly damaging	0.94
R1437:Ror1	UTSW	4	100412109	missense	probably benign
R1441:Ror1	UTSW	4	100440983	missense	probably benign
R1544:Ror1	UTSW	4	100441986	missense	probably damaging	1.00
R1717:Ror1	UTSW	4	100302938	missense	probably benign
R1857:Ror1	UTSW	4	100441503	missense	probably damaging	1.00
R2018:Ror1	UTSW	4	100407841	nonsense	probably null
R2051:Ror1	UTSW	4	100407868	nonsense	probably null
R2127:Ror1	UTSW	4	100442093	missense	probably benign
R2132:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2133:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2176:Ror1	UTSW	4	100441874	missense	probably damaging	0.99
R2431:Ror1	UTSW	4	100441155	missense	probably damaging	1.00
R2896:Ror1	UTSW	4	100096280	missense	unknown
R3005:Ror1	UTSW	4	100441764	missense	probably damaging	0.99
R3780:Ror1	UTSW	4	100412117	missense	probably benign	0.34
R3850:Ror1	UTSW	4	100442160	missense	possibly damaging	0.90
R3861:Ror1	UTSW	4	100407923	missense	possibly damaging	0.46
R4599:Ror1	UTSW	4	100407910	missense	probably damaging	0.99
R4863:Ror1	UTSW	4	100409804	missense	probably damaging	0.99
R4871:Ror1	UTSW	4	100425998	missense	probably benign
R4990:Ror1	UTSW	4	100441964	missense	probably benign
R5023:Ror1	UTSW	4	100425932	missense	probably benign	0.01
R5028:Ror1	UTSW	4	100411936	missense	possibly damaging	0.67
R5079:Ror1	UTSW	4	100441422	missense	probably damaging	1.00
R5294:Ror1	UTSW	4	100425938	missense	probably benign	0.00
R6339:Ror1	UTSW	4	100411931	missense	possibly damaging	0.91
R6491:Ror1	UTSW	4	100409912	missense	possibly damaging	0.94
R6632:Ror1	UTSW	4	100442106	missense	probably benign
R6733:Ror1	UTSW	4	100426055	missense	probably benign
R7022:Ror1	UTSW	4	100407911	missense	probably damaging	1.00
R7054:Ror1	UTSW	4	100442239	missense	probably benign	0.00
R7121:Ror1	UTSW	4	100302945	missense	probably benign	0.00
R7350:Ror1	UTSW	4	100425943	missense	probably benign	0.00
R7492:Ror1	UTSW	4	100441059	missense	probably benign	0.22
R7502:Ror1	UTSW	4	100333630	missense	probably benign	0.03
R7531:Ror1	UTSW	4	100441191	missense	probably damaging	1.00
R7661:Ror1	UTSW	4	100441490	missense	probably damaging	1.00
R7822:Ror1	UTSW	4	100441367	missense	probably damaging	1.00
R7831:Ror1	UTSW	4	100441098	missense	probably benign	0.01
R8366:Ror1	UTSW	4	100409998	missense	possibly damaging	0.91
R8539:Ror1	UTSW	4	100441887	missense	possibly damaging	0.71
R8757:Ror1	UTSW	4	100440883	missense	probably benign	0.01
R8862:Ror1	UTSW	4	100334518	critical splice donor site	probably null
V7580:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
V7583:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
X0020:Ror1	UTSW	4	100426090	missense	probably benign	0.02
Z1177:Ror1	UTSW	4	100302919	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAAGGCTAAAGAGCTGCC -3'
(R):5'- GCTATGTGTAAGAAATCACCATGGTC -3'

Sequencing Primer
(F):5'- AGAGCTGCCTCTTTCCGCTG -3'
(R):5'- GAAATCACCATGGTCCAGGCTG -3'

Posted On

2016-10-24