Mutagenetix > Incidental Mutation

Incidental Mutation 'R5538:Cc2d2a'

434914

Institutional Source

Beutler Lab

Gene Symbol

Cc2d2a

Ensembl Gene

ENSMUSG00000039765

Gene Name

coiled-coil and C2 domain containing 2A

Synonyms

b2b1035Clo, 5730509K17Rik

MMRRC Submission

043096-MU

Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene?

Probably essential (E-score: 0.887) question?

Stock #

R5538 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43662346-43740972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43695176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 365 (I365T)

Ref Sequence

ENSEMBL: ENSMUSP00000114349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]

AlphaFold

Q8CFW7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048150
AA Change: I414T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: I414T

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125866
AA Change: I365T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: I365T

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127355

Meta Mutation Damage Score

0.4630

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

94% (73/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900055J20Rik	T	A	18: 40,257,266	Y97*	probably null	Het
4930467E23Rik	A	C	8: 19,749,414		probably null	Het
Adgrv1	C	A	13: 81,433,689	R4745S	probably benign	Het
Ank3	A	G	10: 69,987,427	E642G	probably damaging	Het
Arhgap11a	G	T	2: 113,837,530	D375E	probably benign	Het
Arl8b	C	A	6: 108,783,336	L28M	probably damaging	Het
Bbs2	G	A	8: 94,089,763	T157M	probably damaging	Het
C2cd3	T	A	7: 100,455,493		probably null	Het
C6	T	A	15: 4,814,829	I911N	possibly damaging	Het
Cd46	T	G	1: 195,068,170		probably null	Het
Ceacam3	A	T	7: 17,158,421	D363V	probably damaging	Het
Cep63	A	T	9: 102,588,793	L678*	probably null	Het
Clasrp	A	C	7: 19,584,782		probably benign	Het
Clk2	T	A	3: 89,175,655	Y412N	probably damaging	Het
Col24a1	C	T	3: 145,293,121	A5V	probably damaging	Het
Cox16	T	C	12: 81,484,929	N13D	possibly damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dhx32	A	T	7: 133,723,217	M437K	probably benign	Het
Dnm2	T	C	9: 21,505,627	F819L	probably benign	Het
Dpysl4	A	G	7: 139,091,990	T85A	probably benign	Het
Dspp	A	T	5: 104,175,230	K80*	probably null	Het
Dync2h1	T	C	9: 7,168,630		probably benign	Het
Ern1	A	G	11: 106,421,901	V218A	possibly damaging	Het
Fbn2	G	A	18: 58,071,901	R1157C	probably benign	Het
Fez1	T	A	9: 36,868,876	I323N	probably damaging	Het
Fmo9	T	A	1: 166,673,629	T199S	probably benign	Het
Fry	T	A	5: 150,495,848	L915Q	probably damaging	Het
Gm10719	T	C	9: 3,018,962	L69S	probably benign	Het
Gnpda2	A	T	5: 69,578,051	H230Q	probably damaging	Het
Gramd1c	T	A	16: 43,982,092	N652I	probably damaging	Het
H2-Bl	T	A	17: 36,081,286	H178L	probably benign	Het
Hells	T	A	19: 38,953,652	F462Y	probably benign	Het
Htr7	A	G	19: 35,969,835	F260L	probably benign	Het
Itsn1	C	A	16: 91,784,102	A23D	probably damaging	Het
Jak3	A	G	8: 71,678,773	D94G	probably benign	Het
Kif20b	A	T	19: 34,952,964	K25*	probably null	Het
Klf2	T	C	8: 72,319,472	L40P	probably damaging	Het
Kmt2a	A	G	9: 44,820,342		probably benign	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Lonrf1	T	A	8: 36,223,024		probably null	Het
Lrp1b	A	T	2: 40,697,474	I154K	unknown	Het
Mybpc1	T	A	10: 88,546,029	I600L	possibly damaging	Het
Npnt	T	C	3: 132,904,963	N285S	probably damaging	Het
Olfr1255	T	A	2: 89,816,620	F92Y	probably damaging	Het
Olfr429	T	C	1: 174,089,978	*313R	probably null	Het
Olfr572	A	G	7: 102,928,521	T298A	probably damaging	Het
Olfr816	T	A	10: 129,912,002	Y92F	probably benign	Het
Pcnx	T	C	12: 81,860,409	V13A	probably damaging	Het
Pddc1	A	G	7: 141,406,845		probably benign	Het
Phkb	G	A	8: 85,922,127	V191I	possibly damaging	Het
Pnpla6	A	G	8: 3,531,508	M594V	probably benign	Het
Prkdc	A	G	16: 15,651,469	E146G	probably damaging	Het
Ror1	T	C	4: 100,441,011	M527T	probably benign	Het
Scnm1	A	G	3: 95,129,755		probably benign	Het
Skint11	A	T	4: 114,231,762	N251I	probably damaging	Het
Slc19a3	T	A	1: 83,022,561	N245I	possibly damaging	Het
Slc1a3	A	T	15: 8,645,704	D272E	probably damaging	Het
Smok2b	T	A	17: 13,235,553	V200D	possibly damaging	Het
Sspo	T	C	6: 48,452,178	Y417H	probably damaging	Het
Stk11ip	C	A	1: 75,528,335	S388R	probably damaging	Het
Svep1	T	C	4: 58,049,282		probably null	Het
Sytl2	A	G	7: 90,388,906	I525V	probably benign	Het
Tie1	T	C	4: 118,486,193	N158D	probably benign	Het
Tle2	T	C	10: 81,580,584	L180P	probably damaging	Het
Txlnb	T	C	10: 17,838,909	L363P	probably damaging	Het
Upk3b	C	G	5: 136,044,036	A258G	probably benign	Het
Usp32	A	T	11: 85,017,786	D1031E	possibly damaging	Het
Vmn2r116	C	T	17: 23,401,067	L592F	probably benign	Het
Zfp607b	A	G	7: 27,702,869	H250R	probably damaging	Het

Other mutations in Cc2d2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cc2d2a	APN	5	43724380	splice site	probably benign
IGL00937:Cc2d2a	APN	5	43688122	critical splice acceptor site	probably null
IGL01322:Cc2d2a	APN	5	43689003	missense	probably benign	0.00
IGL01349:Cc2d2a	APN	5	43723784	missense	probably benign	0.01
IGL01448:Cc2d2a	APN	5	43684185	missense	possibly damaging	0.65
IGL01871:Cc2d2a	APN	5	43688969	missense	probably damaging	0.98
IGL01947:Cc2d2a	APN	5	43688237	missense	probably damaging	0.96
IGL01976:Cc2d2a	APN	5	43683115	missense	probably benign	0.02
IGL02113:Cc2d2a	APN	5	43685248	splice site	probably null
IGL02364:Cc2d2a	APN	5	43735450	missense	probably damaging	1.00
IGL02448:Cc2d2a	APN	5	43683205	splice site	probably benign
IGL02458:Cc2d2a	APN	5	43718554	missense	probably benign	0.01
IGL02542:Cc2d2a	APN	5	43688910	splice site	probably benign
IGL02834:Cc2d2a	APN	5	43714521	nonsense	probably null
IGL02940:Cc2d2a	APN	5	43728294	splice site	probably null
IGL03003:Cc2d2a	APN	5	43671266	missense	probably benign	0.22
IGL03183:Cc2d2a	APN	5	43732379	missense	probably damaging	1.00
C9142:Cc2d2a	UTSW	5	43735457	splice site	probably benign
P0028:Cc2d2a	UTSW	5	43684199	missense	probably benign
R0193:Cc2d2a	UTSW	5	43736118	missense	probably damaging	1.00
R0201:Cc2d2a	UTSW	5	43737512	missense	probably damaging	1.00
R0211:Cc2d2a	UTSW	5	43688266	splice site	probably null
R0243:Cc2d2a	UTSW	5	43696638	splice site	probably benign
R0317:Cc2d2a	UTSW	5	43706901	critical splice donor site	probably null
R0453:Cc2d2a	UTSW	5	43703294	missense	probably benign	0.00
R0558:Cc2d2a	UTSW	5	43724387	splice site	probably benign
R0624:Cc2d2a	UTSW	5	43730029	missense	probably benign
R0634:Cc2d2a	UTSW	5	43681381	splice site	probably benign
R1503:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R1635:Cc2d2a	UTSW	5	43722470	missense	probably damaging	1.00
R1686:Cc2d2a	UTSW	5	43739371	missense	possibly damaging	0.81
R1707:Cc2d2a	UTSW	5	43723688	splice site	probably null
R1715:Cc2d2a	UTSW	5	43718661	missense	probably damaging	0.97
R1765:Cc2d2a	UTSW	5	43714531	missense	probably damaging	0.99
R1794:Cc2d2a	UTSW	5	43688252	missense	probably damaging	1.00
R1881:Cc2d2a	UTSW	5	43740828	missense	probably damaging	0.99
R1917:Cc2d2a	UTSW	5	43706222	missense	probably damaging	1.00
R2005:Cc2d2a	UTSW	5	43726373	critical splice donor site	probably null
R2201:Cc2d2a	UTSW	5	43684033	splice site	probably benign
R2244:Cc2d2a	UTSW	5	43732433	missense	probably damaging	1.00
R2368:Cc2d2a	UTSW	5	43703888	missense	probably benign
R2442:Cc2d2a	UTSW	5	43671305	critical splice donor site	probably null
R2511:Cc2d2a	UTSW	5	43735395	missense	probably damaging	0.99
R3023:Cc2d2a	UTSW	5	43685251	splice site	probably null
R3147:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3148:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3426:Cc2d2a	UTSW	5	43736109	missense	probably benign	0.00
R3609:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3610:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3611:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3839:Cc2d2a	UTSW	5	43718714	missense	probably benign
R3870:Cc2d2a	UTSW	5	43718691	nonsense	probably null
R4334:Cc2d2a	UTSW	5	43683134	missense	probably benign	0.00
R4913:Cc2d2a	UTSW	5	43739323	missense	probably benign	0.12
R5179:Cc2d2a	UTSW	5	43688221	missense	possibly damaging	0.82
R5315:Cc2d2a	UTSW	5	43720433	missense	probably damaging	0.99
R5352:Cc2d2a	UTSW	5	43706213	missense	probably damaging	1.00
R5386:Cc2d2a	UTSW	5	43730041	missense	probably benign	0.01
R5568:Cc2d2a	UTSW	5	43709091	missense	probably damaging	0.99
R5618:Cc2d2a	UTSW	5	43729907	missense	probably benign	0.00
R5653:Cc2d2a	UTSW	5	43722462	missense	possibly damaging	0.81
R5817:Cc2d2a	UTSW	5	43712418	missense	probably damaging	1.00
R5858:Cc2d2a	UTSW	5	43715775	missense	probably damaging	1.00
R5905:Cc2d2a	UTSW	5	43712426	missense	probably benign
R5912:Cc2d2a	UTSW	5	43720430	missense	probably damaging	0.97
R6073:Cc2d2a	UTSW	5	43729975	missense	probably damaging	1.00
R6084:Cc2d2a	UTSW	5	43668673	missense	probably benign
R6142:Cc2d2a	UTSW	5	43703198	missense	probably damaging	0.97
R6176:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.32
R6238:Cc2d2a	UTSW	5	43671235	missense	probably benign	0.11
R6381:Cc2d2a	UTSW	5	43715776	missense	possibly damaging	0.69
R6404:Cc2d2a	UTSW	5	43704074	missense	possibly damaging	0.58
R6455:Cc2d2a	UTSW	5	43739412	missense	possibly damaging	0.69
R6695:Cc2d2a	UTSW	5	43718677	missense	probably damaging	0.99
R6805:Cc2d2a	UTSW	5	43681331	missense	probably damaging	1.00
R6919:Cc2d2a	UTSW	5	43703215	missense	probably benign	0.19
R6970:Cc2d2a	UTSW	5	43718585	missense	probably damaging	1.00
R7024:Cc2d2a	UTSW	5	43733929	missense	probably benign	0.10
R7054:Cc2d2a	UTSW	5	43699979	nonsense	probably null
R7071:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.13
R7098:Cc2d2a	UTSW	5	43683139	missense	probably benign	0.00
R7366:Cc2d2a	UTSW	5	43729990	missense	probably damaging	1.00
R7908:Cc2d2a	UTSW	5	43706846	missense	probably benign	0.00
R7920:Cc2d2a	UTSW	5	43739309	missense	probably benign	0.09
R7950:Cc2d2a	UTSW	5	43695296	critical splice donor site	probably null
R8007:Cc2d2a	UTSW	5	43706100	missense	possibly damaging	0.71
R8117:Cc2d2a	UTSW	5	43712439	missense	probably damaging	1.00
R8123:Cc2d2a	UTSW	5	43710554	missense	probably benign
R8179:Cc2d2a	UTSW	5	43699953	missense	probably damaging	0.96
R8279:Cc2d2a	UTSW	5	43736145	missense	probably benign	0.01
R8293:Cc2d2a	UTSW	5	43688228	missense	probably damaging	0.97
R8480:Cc2d2a	UTSW	5	43685144	splice site	probably null
R8482:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R8731:Cc2d2a	UTSW	5	43735446	missense	probably damaging	1.00
R8780:Cc2d2a	UTSW	5	43739350	missense	probably damaging	1.00
R8784:Cc2d2a	UTSW	5	43703303	missense	possibly damaging	0.90
R8871:Cc2d2a	UTSW	5	43699943	missense	possibly damaging	0.71
R8972:Cc2d2a	UTSW	5	43710542	missense	probably benign
R9122:Cc2d2a	UTSW	5	43673739	missense	probably null	0.07
R9125:Cc2d2a	UTSW	5	43703221	missense	probably benign
R9203:Cc2d2a	UTSW	5	43733837	missense	probably benign	0.01
R9310:Cc2d2a	UTSW	5	43695146	missense	probably damaging	1.00
R9343:Cc2d2a	UTSW	5	43718657	missense	probably damaging	1.00
R9353:Cc2d2a	UTSW	5	43703349	critical splice donor site	probably null
Z1177:Cc2d2a	UTSW	5	43703204	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAAATGCTCCAGGCCATCAG -3'
(R):5'- TGGGTTAATCAGAAGAACCAGC -3'

Sequencing Primer
(F):5'- TCAGCAGCAAAACACAAGACTTTAAG -3'
(R):5'- GTTAATCAGAAGAACCAGCCCCATC -3'

Posted On

2016-10-24