Incidental Mutation 'R5538:Jak3'
ID434935
Institutional Source Beutler Lab
Gene Symbol Jak3
Ensembl Gene ENSMUSG00000031805
Gene NameJanus kinase 3
Synonymsfae; wil
MMRRC Submission 043096-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R5538 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71676296-71690575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71678773 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 94 (D94G)
Ref Sequence ENSEMBL: ENSMUSP00000105640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably benign
Transcript: ENSMUST00000051995
AA Change: D94G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: D94G

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110012
AA Change: D94G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: D94G

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110013
AA Change: D94G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: D94G

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133263
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik T A 18: 40,257,266 Y97* probably null Het
4930467E23Rik A C 8: 19,749,414 probably null Het
Adgrv1 C A 13: 81,433,689 R4745S probably benign Het
Ank3 A G 10: 69,987,427 E642G probably damaging Het
Arhgap11a G T 2: 113,837,530 D375E probably benign Het
Arl8b C A 6: 108,783,336 L28M probably damaging Het
Bbs2 G A 8: 94,089,763 T157M probably damaging Het
C2cd3 T A 7: 100,455,493 probably null Het
C6 T A 15: 4,814,829 I911N possibly damaging Het
Cc2d2a T C 5: 43,695,176 I365T possibly damaging Het
Cd46 T G 1: 195,068,170 probably null Het
Ceacam3 A T 7: 17,158,421 D363V probably damaging Het
Cep63 A T 9: 102,588,793 L678* probably null Het
Clasrp A C 7: 19,584,782 probably benign Het
Clk2 T A 3: 89,175,655 Y412N probably damaging Het
Col24a1 C T 3: 145,293,121 A5V probably damaging Het
Cox16 T C 12: 81,484,929 N13D possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx32 A T 7: 133,723,217 M437K probably benign Het
Dnm2 T C 9: 21,505,627 F819L probably benign Het
Dpysl4 A G 7: 139,091,990 T85A probably benign Het
Dspp A T 5: 104,175,230 K80* probably null Het
Dync2h1 T C 9: 7,168,630 probably benign Het
Ern1 A G 11: 106,421,901 V218A possibly damaging Het
Fbn2 G A 18: 58,071,901 R1157C probably benign Het
Fez1 T A 9: 36,868,876 I323N probably damaging Het
Fmo9 T A 1: 166,673,629 T199S probably benign Het
Fry T A 5: 150,495,848 L915Q probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gnpda2 A T 5: 69,578,051 H230Q probably damaging Het
Gramd1c T A 16: 43,982,092 N652I probably damaging Het
H2-Bl T A 17: 36,081,286 H178L probably benign Het
Hells T A 19: 38,953,652 F462Y probably benign Het
Htr7 A G 19: 35,969,835 F260L probably benign Het
Itsn1 C A 16: 91,784,102 A23D probably damaging Het
Kif20b A T 19: 34,952,964 K25* probably null Het
Klf2 T C 8: 72,319,472 L40P probably damaging Het
Kmt2a A G 9: 44,820,342 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lonrf1 T A 8: 36,223,024 probably null Het
Lrp1b A T 2: 40,697,474 I154K unknown Het
Mybpc1 T A 10: 88,546,029 I600L possibly damaging Het
Npnt T C 3: 132,904,963 N285S probably damaging Het
Olfr1255 T A 2: 89,816,620 F92Y probably damaging Het
Olfr429 T C 1: 174,089,978 *313R probably null Het
Olfr572 A G 7: 102,928,521 T298A probably damaging Het
Olfr816 T A 10: 129,912,002 Y92F probably benign Het
Pcnx T C 12: 81,860,409 V13A probably damaging Het
Pddc1 A G 7: 141,406,845 probably benign Het
Phkb G A 8: 85,922,127 V191I possibly damaging Het
Pnpla6 A G 8: 3,531,508 M594V probably benign Het
Prkdc A G 16: 15,651,469 E146G probably damaging Het
Ror1 T C 4: 100,441,011 M527T probably benign Het
Scnm1 A G 3: 95,129,755 probably benign Het
Skint11 A T 4: 114,231,762 N251I probably damaging Het
Slc19a3 T A 1: 83,022,561 N245I possibly damaging Het
Slc1a3 A T 15: 8,645,704 D272E probably damaging Het
Smok2b T A 17: 13,235,553 V200D possibly damaging Het
Sspo T C 6: 48,452,178 Y417H probably damaging Het
Stk11ip C A 1: 75,528,335 S388R probably damaging Het
Svep1 T C 4: 58,049,282 probably null Het
Sytl2 A G 7: 90,388,906 I525V probably benign Het
Tie1 T C 4: 118,486,193 N158D probably benign Het
Tle2 T C 10: 81,580,584 L180P probably damaging Het
Txlnb T C 10: 17,838,909 L363P probably damaging Het
Upk3b C G 5: 136,044,036 A258G probably benign Het
Usp32 A T 11: 85,017,786 D1031E possibly damaging Het
Vmn2r116 C T 17: 23,401,067 L592F probably benign Het
Zfp607b A G 7: 27,702,869 H250R probably damaging Het
Other mutations in Jak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Downcast UTSW 8 71685511 missense probably benign 0.07
fake_news UTSW 8 71685957 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
R7440:Jak3 UTSW 8 71680718 missense probably benign 0.02
R7489:Jak3 UTSW 8 71684292 missense probably damaging 1.00
R7773:Jak3 UTSW 8 71679042 missense probably benign
R7779:Jak3 UTSW 8 71687288 missense probably benign 0.01
Z1176:Jak3 UTSW 8 71680683 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCCTAGATGACCATGCCATG -3'
(R):5'- AAGCGGTGACATGTCTCCAG -3'

Sequencing Primer
(F):5'- GATGACCATGCCATGTAATAGC -3'
(R):5'- TAAAAGCTGTGGGTTTCAGAATG -3'
Posted On2016-10-24