Incidental Mutation 'R0190:Gigyf2'
ID43494
Institutional Source Beutler Lab
Gene Symbol Gigyf2
Ensembl Gene ENSMUSG00000048000
Gene NameGRB10 interacting GYF protein 2
Synonyms2610016F01Rik, Tnrc15, A830080H02Rik
MMRRC Submission 038451-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R0190 (G1)
Quality Score113
Status Validated (trace)
Chromosome1
Chromosomal Location87326998-87450796 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 87428688 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000164992] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173173] [ENSMUST00000174501]
Predicted Effect unknown
Transcript: ENSMUST00000027475
AA Change: E831V
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000
AA Change: E831V

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164992
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172794
AA Change: E825V
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000
AA Change: E825V

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172964
AA Change: E831V
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000
AA Change: E831V

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173173
AA Change: E824V
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000
AA Change: E824V

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173235
AA Change: E652V
SMART Domains Protein: ENSMUSP00000134677
Gene: ENSMUSG00000048000
AA Change: E652V

DomainStartEndE-ValueType
low complexity region 69 107 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
internal_repeat_1 166 206 3.2e-5 PROSPERO
internal_repeat_1 226 262 3.2e-5 PROSPERO
GYF 357 412 2.83e-26 SMART
low complexity region 442 489 N/A INTRINSIC
coiled coil region 544 745 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174501
AA Change: E831V
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000
AA Change: E831V

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174671
Meta Mutation Damage Score 0.1784 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains CAG trinucleotide repeats and encodes a protein containing several stretches of polyglutamine residues. The encoded protein may be involved in the regulation of tyrosine kinase receptor signaling. This gene is located in a chromosomal region that was genetically linked to Parkinson disease type 11, and mutations in this gene were thought to be causative for this disease. However, more recent studies in different populations have been unable to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal and postnatal lethality. Mice heterozygous for a knock-out allele exhibit impaired motor coordination with motor neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,392 probably null Het
Aff2 CA CAAA X: 69,849,105 probably null Het
Ankrd34a A G 3: 96,597,789 D103G probably damaging Het
Atp1b2 T C 11: 69,601,562 D224G probably damaging Het
Atxn10 A G 15: 85,336,529 D22G possibly damaging Het
B230118H07Rik G A 2: 101,586,430 S58L probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Caskin1 C T 17: 24,504,622 L795F possibly damaging Het
Cdk12 T C 11: 98,241,831 probably null Het
Crtc2 A G 3: 90,259,409 H91R probably damaging Het
Dbt A G 3: 116,539,087 probably null Het
Dda1 C A 8: 71,472,233 Y41* probably null Het
Dnah2 T A 11: 69,435,249 D3692V probably damaging Het
Dpep1 A G 8: 123,200,708 T334A probably benign Het
Enthd1 C T 15: 80,534,494 probably null Het
Fpr-rs6 T A 17: 20,182,479 I207F probably benign Het
Fsip2 T A 2: 82,985,177 S3751R possibly damaging Het
Gtf3c4 C A 2: 28,840,128 D34Y probably benign Het
Igfn1 A T 1: 135,962,052 V2419E probably damaging Het
Kank1 A T 19: 25,409,283 I79L probably benign Het
Kif21b A G 1: 136,171,219 H1415R probably benign Het
Mad2l1 T C 6: 66,539,878 S185P possibly damaging Het
Mettl18 A G 1: 163,996,422 E104G probably damaging Het
Mrgprb2 G A 7: 48,552,777 H67Y possibly damaging Het
Mrgprd G A 7: 145,321,702 M103I probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Nucks1 A G 1: 131,924,591 D60G probably damaging Het
Olfr1245 T A 2: 89,574,958 Y256F probably damaging Het
Olfr275 G C 4: 52,825,613 W72S probably damaging Het
Olfr978 A G 9: 39,994,544 I245V probably benign Het
Paqr8 A G 1: 20,935,047 T142A probably benign Het
Pdss1 T C 2: 22,906,831 S119P probably damaging Het
Plcl2 A G 17: 50,607,643 D560G probably benign Het
Ppm1b T A 17: 84,994,103 V137E probably damaging Het
Ppp1r16b A C 2: 158,696,063 K35Q probably damaging Het
Prkd2 A T 7: 16,869,890 E832V probably damaging Het
Rab34 G T 11: 78,191,406 K191N possibly damaging Het
Rad51ap2 A C 12: 11,458,539 T821P probably benign Het
Rbm19 A G 5: 120,144,046 T823A probably benign Het
Rpf2 T G 10: 40,227,601 H106P probably damaging Het
Schip1 A G 3: 68,625,844 M453V probably benign Het
Sema5a T A 15: 32,562,774 N310K possibly damaging Het
Sf3b1 T C 1: 54,990,306 D1179G probably damaging Het
Skint2 A T 4: 112,616,532 T4S possibly damaging Het
Slc22a5 A T 11: 53,869,415 Y358* probably null Het
Slc34a1 T C 13: 55,409,101 M251T probably benign Het
Slc44a5 A G 3: 154,239,118 D124G probably null Het
Slc9b1 G A 3: 135,357,673 E73K unknown Het
Ssbp2 T C 13: 91,669,710 L156P probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Trim47 A G 11: 116,106,227 V568A probably damaging Het
Ttn A T 2: 76,887,980 probably benign Het
Ttpa A T 4: 20,021,260 I74F probably damaging Het
Vmn2r52 T C 7: 10,171,388 I175V probably benign Het
Wrn C T 8: 33,240,983 C1350Y probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp422 A T 6: 116,626,611 D142E probably damaging Het
Zfp473 A T 7: 44,733,188 C574S probably damaging Het
Zfp638 T A 6: 83,928,964 M37K probably damaging Het
Zfp976 C A 7: 42,642,524 probably benign Het
Other mutations in Gigyf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gigyf2 APN 1 87436850 missense probably damaging 0.99
IGL01828:Gigyf2 APN 1 87419098 missense probably damaging 1.00
IGL02222:Gigyf2 APN 1 87410863 unclassified probably null
IGL02259:Gigyf2 APN 1 87411837 missense probably damaging 1.00
IGL02562:Gigyf2 APN 1 87407375 missense probably benign 0.15
IGL02565:Gigyf2 APN 1 87442136 missense probably damaging 1.00
IGL02695:Gigyf2 APN 1 87416827 missense probably benign 0.07
IGL03264:Gigyf2 APN 1 87449068 splice site probably benign
Flop UTSW 1 87365266 missense probably damaging 1.00
FR4449:Gigyf2 UTSW 1 87428585 unclassified probably benign
PIT4260001:Gigyf2 UTSW 1 87419106 missense unknown
R0041:Gigyf2 UTSW 1 87378976 missense probably damaging 1.00
R0126:Gigyf2 UTSW 1 87411875 splice site probably benign
R0244:Gigyf2 UTSW 1 87379015 missense possibly damaging 0.96
R0492:Gigyf2 UTSW 1 87440846 missense probably damaging 1.00
R0526:Gigyf2 UTSW 1 87421493 missense probably benign 0.00
R0612:Gigyf2 UTSW 1 87449080 missense probably damaging 1.00
R0731:Gigyf2 UTSW 1 87407727 splice site probably benign
R0783:Gigyf2 UTSW 1 87407161 missense probably damaging 0.99
R1445:Gigyf2 UTSW 1 87443638 splice site probably benign
R1620:Gigyf2 UTSW 1 87449128 missense probably damaging 1.00
R1678:Gigyf2 UTSW 1 87416983 missense probably benign 0.44
R2008:Gigyf2 UTSW 1 87374113 critical splice donor site probably null
R2111:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2112:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2180:Gigyf2 UTSW 1 87416920 missense probably damaging 1.00
R3438:Gigyf2 UTSW 1 87440580 missense probably damaging 0.96
R3690:Gigyf2 UTSW 1 87421516 missense possibly damaging 0.80
R4089:Gigyf2 UTSW 1 87443672 missense probably damaging 1.00
R4411:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4412:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4489:Gigyf2 UTSW 1 87440826 missense probably damaging 1.00
R4743:Gigyf2 UTSW 1 87365248 nonsense probably null
R4769:Gigyf2 UTSW 1 87440849 missense probably damaging 1.00
R4854:Gigyf2 UTSW 1 87354413 unclassified probably benign
R5215:Gigyf2 UTSW 1 87365266 missense probably damaging 1.00
R5326:Gigyf2 UTSW 1 87425138 unclassified probably benign
R5771:Gigyf2 UTSW 1 87446328 missense possibly damaging 0.90
R5813:Gigyf2 UTSW 1 87440763 missense probably damaging 0.99
R5964:Gigyf2 UTSW 1 87407167 missense probably damaging 1.00
R6026:Gigyf2 UTSW 1 87440732 missense probably damaging 0.99
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6784:Gigyf2 UTSW 1 87443674 missense probably damaging 1.00
R6800:Gigyf2 UTSW 1 87419176 missense possibly damaging 0.68
R6991:Gigyf2 UTSW 1 87407136 missense probably damaging 1.00
R7224:Gigyf2 UTSW 1 87403725 missense unknown
R7464:Gigyf2 UTSW 1 87428604 missense unknown
R7554:Gigyf2 UTSW 1 87407570 missense unknown
R7658:Gigyf2 UTSW 1 87419138 missense unknown
R8032:Gigyf2 UTSW 1 87407013 missense unknown
R8070:Gigyf2 UTSW 1 87440907 missense probably benign 0.03
X0065:Gigyf2 UTSW 1 87411867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTCCATATCTGCGCCTAGCTTC -3'
(R):5'- CCCACACCATAGTGTGCTTTTACCA -3'

Sequencing Primer
(F):5'- ccctctgccctgtgacc -3'
(R):5'- CACCATAGTGTGCTTTTACCATAGAG -3'
Posted On2013-05-24