Mutagenetix > Incidental Mutation

Incidental Mutation 'R5538:Mybpc1'

434944

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

043096-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.806) question?

Stock #

R5538 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88546029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 600 (I600L)

Ref Sequence

ENSEMBL: ENSMUSP00000112615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

AlphaFold

A0A571BEN1

Predicted Effect

probably benign
Transcript: ENSMUST00000119185
AA Change: I586L

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: I586L

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121629
AA Change: I600L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: I600L

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000156573
AA Change: I225L

SMART Domains

Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: I225L

Domain	Start	End	E-Value	Type
PDB:1X44\|A	2	58	1e-26	PDB
IG	66	146	6.97e-3	SMART
IG	159	244	2.83e-3	SMART
FN3	247	330	4.28e-10	SMART
FN3	345	446	1.6e-9	SMART
low complexity region	458	470	N/A	INTRINSIC
IG	473	556	9.06e-2	SMART
FN3	559	617	8.17e0	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

94% (73/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900055J20Rik	T	A	18: 40,257,266	Y97*	probably null	Het
4930467E23Rik	A	C	8: 19,749,414		probably null	Het
Adgrv1	C	A	13: 81,433,689	R4745S	probably benign	Het
Ank3	A	G	10: 69,987,427	E642G	probably damaging	Het
Arhgap11a	G	T	2: 113,837,530	D375E	probably benign	Het
Arl8b	C	A	6: 108,783,336	L28M	probably damaging	Het
Bbs2	G	A	8: 94,089,763	T157M	probably damaging	Het
C2cd3	T	A	7: 100,455,493		probably null	Het
C6	T	A	15: 4,814,829	I911N	possibly damaging	Het
Cc2d2a	T	C	5: 43,695,176	I365T	possibly damaging	Het
Cd46	T	G	1: 195,068,170		probably null	Het
Ceacam3	A	T	7: 17,158,421	D363V	probably damaging	Het
Cep63	A	T	9: 102,588,793	L678*	probably null	Het
Clasrp	A	C	7: 19,584,782		probably benign	Het
Clk2	T	A	3: 89,175,655	Y412N	probably damaging	Het
Col24a1	C	T	3: 145,293,121	A5V	probably damaging	Het
Cox16	T	C	12: 81,484,929	N13D	possibly damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dhx32	A	T	7: 133,723,217	M437K	probably benign	Het
Dnm2	T	C	9: 21,505,627	F819L	probably benign	Het
Dpysl4	A	G	7: 139,091,990	T85A	probably benign	Het
Dspp	A	T	5: 104,175,230	K80*	probably null	Het
Dync2h1	T	C	9: 7,168,630		probably benign	Het
Ern1	A	G	11: 106,421,901	V218A	possibly damaging	Het
Fbn2	G	A	18: 58,071,901	R1157C	probably benign	Het
Fez1	T	A	9: 36,868,876	I323N	probably damaging	Het
Fmo9	T	A	1: 166,673,629	T199S	probably benign	Het
Fry	T	A	5: 150,495,848	L915Q	probably damaging	Het
Gm10719	T	C	9: 3,018,962	L69S	probably benign	Het
Gnpda2	A	T	5: 69,578,051	H230Q	probably damaging	Het
Gramd1c	T	A	16: 43,982,092	N652I	probably damaging	Het
H2-Bl	T	A	17: 36,081,286	H178L	probably benign	Het
Hells	T	A	19: 38,953,652	F462Y	probably benign	Het
Htr7	A	G	19: 35,969,835	F260L	probably benign	Het
Itsn1	C	A	16: 91,784,102	A23D	probably damaging	Het
Jak3	A	G	8: 71,678,773	D94G	probably benign	Het
Kif20b	A	T	19: 34,952,964	K25*	probably null	Het
Klf2	T	C	8: 72,319,472	L40P	probably damaging	Het
Kmt2a	A	G	9: 44,820,342		probably benign	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Lonrf1	T	A	8: 36,223,024		probably null	Het
Lrp1b	A	T	2: 40,697,474	I154K	unknown	Het
Npnt	T	C	3: 132,904,963	N285S	probably damaging	Het
Olfr1255	T	A	2: 89,816,620	F92Y	probably damaging	Het
Olfr429	T	C	1: 174,089,978	*313R	probably null	Het
Olfr572	A	G	7: 102,928,521	T298A	probably damaging	Het
Olfr816	T	A	10: 129,912,002	Y92F	probably benign	Het
Pcnx	T	C	12: 81,860,409	V13A	probably damaging	Het
Pddc1	A	G	7: 141,406,845		probably benign	Het
Phkb	G	A	8: 85,922,127	V191I	possibly damaging	Het
Pnpla6	A	G	8: 3,531,508	M594V	probably benign	Het
Prkdc	A	G	16: 15,651,469	E146G	probably damaging	Het
Ror1	T	C	4: 100,441,011	M527T	probably benign	Het
Scnm1	A	G	3: 95,129,755		probably benign	Het
Skint11	A	T	4: 114,231,762	N251I	probably damaging	Het
Slc19a3	T	A	1: 83,022,561	N245I	possibly damaging	Het
Slc1a3	A	T	15: 8,645,704	D272E	probably damaging	Het
Smok2b	T	A	17: 13,235,553	V200D	possibly damaging	Het
Sspo	T	C	6: 48,452,178	Y417H	probably damaging	Het
Stk11ip	C	A	1: 75,528,335	S388R	probably damaging	Het
Svep1	T	C	4: 58,049,282		probably null	Het
Sytl2	A	G	7: 90,388,906	I525V	probably benign	Het
Tie1	T	C	4: 118,486,193	N158D	probably benign	Het
Tle2	T	C	10: 81,580,584	L180P	probably damaging	Het
Txlnb	T	C	10: 17,838,909	L363P	probably damaging	Het
Upk3b	C	G	5: 136,044,036	A258G	probably benign	Het
Usp32	A	T	11: 85,017,786	D1031E	possibly damaging	Het
Vmn2r116	C	T	17: 23,401,067	L592F	probably benign	Het
Zfp607b	A	G	7: 27,702,869	H250R	probably damaging	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2270:Mybpc1	UTSW	10	88551407	missense	probably benign	0.01
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4878:Mybpc1	UTSW	10	88551430	missense	possibly damaging	0.95
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6324:Mybpc1	UTSW	10	88568619	missense	possibly damaging	0.56
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6973:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7577:Mybpc1	UTSW	10	88549325	missense	probably damaging	1.00
R7660:Mybpc1	UTSW	10	88548854	missense	possibly damaging	0.51
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R8360:Mybpc1	UTSW	10	88573497	nonsense	probably null
R8494:Mybpc1	UTSW	10	88526429	missense	probably benign	0.01
R8849:Mybpc1	UTSW	10	88571585	missense	probably benign	0.01
R8936:Mybpc1	UTSW	10	88558575	missense	probably benign	0.44
R9031:Mybpc1	UTSW	10	88523044	missense	probably damaging	0.99
R9061:Mybpc1	UTSW	10	88555639	missense	probably damaging	1.00
R9081:Mybpc1	UTSW	10	88553306	missense	probably damaging	1.00
R9172:Mybpc1	UTSW	10	88543753	missense	possibly damaging	0.93
R9323:Mybpc1	UTSW	10	88524967	critical splice donor site	probably null
R9460:Mybpc1	UTSW	10	88536335	missense	probably damaging	0.99
R9488:Mybpc1	UTSW	10	88543762	missense	possibly damaging	0.47
R9757:Mybpc1	UTSW	10	88536395	missense	probably damaging	1.00
R9796:Mybpc1	UTSW	10	88570635	missense	possibly damaging	0.56
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCTCCAGTGAGTTCTCTAGATGAG -3'
(R):5'- GTACAGGTCAGACACTTGGG -3'

Sequencing Primer
(F):5'- GAAGGAAGGTAACACAAAGAAAAAC -3'
(R):5'- TCAGACACTTGGGCCCGC -3'

Posted On

2016-10-24