Incidental Mutation 'R5538:Pcnx'
ID434949
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 043096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5538 (G1)
Quality Score114
Status Validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81860409 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000152302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably damaging
Transcript: ENSMUST00000021567
AA Change: V13A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: V13A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221721
AA Change: V13A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000222005
AA Change: V13A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2239 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik T A 18: 40,257,266 Y97* probably null Het
4930467E23Rik A C 8: 19,749,414 probably null Het
Adgrv1 C A 13: 81,433,689 R4745S probably benign Het
Ank3 A G 10: 69,987,427 E642G probably damaging Het
Arhgap11a G T 2: 113,837,530 D375E probably benign Het
Arl8b C A 6: 108,783,336 L28M probably damaging Het
Bbs2 G A 8: 94,089,763 T157M probably damaging Het
C2cd3 T A 7: 100,455,493 probably null Het
C6 T A 15: 4,814,829 I911N possibly damaging Het
Cc2d2a T C 5: 43,695,176 I365T possibly damaging Het
Cd46 T G 1: 195,068,170 probably null Het
Ceacam3 A T 7: 17,158,421 D363V probably damaging Het
Cep63 A T 9: 102,588,793 L678* probably null Het
Clasrp A C 7: 19,584,782 probably benign Het
Clk2 T A 3: 89,175,655 Y412N probably damaging Het
Col24a1 C T 3: 145,293,121 A5V probably damaging Het
Cox16 T C 12: 81,484,929 N13D possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dhx32 A T 7: 133,723,217 M437K probably benign Het
Dnm2 T C 9: 21,505,627 F819L probably benign Het
Dpysl4 A G 7: 139,091,990 T85A probably benign Het
Dspp A T 5: 104,175,230 K80* probably null Het
Dync2h1 T C 9: 7,168,630 probably benign Het
Ern1 A G 11: 106,421,901 V218A possibly damaging Het
Fbn2 G A 18: 58,071,901 R1157C probably benign Het
Fez1 T A 9: 36,868,876 I323N probably damaging Het
Fmo9 T A 1: 166,673,629 T199S probably benign Het
Fry T A 5: 150,495,848 L915Q probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gnpda2 A T 5: 69,578,051 H230Q probably damaging Het
Gramd1c T A 16: 43,982,092 N652I probably damaging Het
H2-Bl T A 17: 36,081,286 H178L probably benign Het
Hells T A 19: 38,953,652 F462Y probably benign Het
Htr7 A G 19: 35,969,835 F260L probably benign Het
Itsn1 C A 16: 91,784,102 A23D probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Kif20b A T 19: 34,952,964 K25* probably null Het
Klf2 T C 8: 72,319,472 L40P probably damaging Het
Kmt2a A G 9: 44,820,342 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lonrf1 T A 8: 36,223,024 probably null Het
Lrp1b A T 2: 40,697,474 I154K unknown Het
Mybpc1 T A 10: 88,546,029 I600L possibly damaging Het
Npnt T C 3: 132,904,963 N285S probably damaging Het
Olfr1255 T A 2: 89,816,620 F92Y probably damaging Het
Olfr429 T C 1: 174,089,978 *313R probably null Het
Olfr572 A G 7: 102,928,521 T298A probably damaging Het
Olfr816 T A 10: 129,912,002 Y92F probably benign Het
Pddc1 A G 7: 141,406,845 probably benign Het
Phkb G A 8: 85,922,127 V191I possibly damaging Het
Pnpla6 A G 8: 3,531,508 M594V probably benign Het
Prkdc A G 16: 15,651,469 E146G probably damaging Het
Ror1 T C 4: 100,441,011 M527T probably benign Het
Scnm1 A G 3: 95,129,755 probably benign Het
Skint11 A T 4: 114,231,762 N251I probably damaging Het
Slc19a3 T A 1: 83,022,561 N245I possibly damaging Het
Slc1a3 A T 15: 8,645,704 D272E probably damaging Het
Smok2b T A 17: 13,235,553 V200D possibly damaging Het
Sspo T C 6: 48,452,178 Y417H probably damaging Het
Stk11ip C A 1: 75,528,335 S388R probably damaging Het
Svep1 T C 4: 58,049,282 probably null Het
Sytl2 A G 7: 90,388,906 I525V probably benign Het
Tie1 T C 4: 118,486,193 N158D probably benign Het
Tle2 T C 10: 81,580,584 L180P probably damaging Het
Txlnb T C 10: 17,838,909 L363P probably damaging Het
Upk3b C G 5: 136,044,036 A258G probably benign Het
Usp32 A T 11: 85,017,786 D1031E possibly damaging Het
Vmn2r116 C T 17: 23,401,067 L592F probably benign Het
Zfp607b A G 7: 27,702,869 H250R probably damaging Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- CTCGAAGACAAGATGGCGGC -3'
(R):5'- AGGTAGATAGTCCGAGGCCC -3'

Sequencing Primer
(F):5'- TCCTCCTCGTGCAGCAG -3'
(R):5'- TTACGCAGACCCGCACGAG -3'
Posted On2016-10-24