Incidental Mutation 'R5548:Cox4i2'
List |< first << previous [record 5 of 45] next >> last >|
ID434971
Institutional Source Beutler Lab
Gene Symbol Cox4i2
Ensembl Gene ENSMUSG00000009876
Gene Namecytochrome c oxidase subunit 4I2
SynonymsCox4b, Cox IV-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152754173-152765037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152757091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 56 (T56I)
Ref Sequence ENSEMBL: ENSMUSP00000105446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010020] [ENSMUST00000109821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010020
AA Change: T56I

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000010020
Gene: ENSMUSG00000009876
AA Change: T56I

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:COX4 30 171 4.1e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109821
AA Change: T56I

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105446
Gene: ENSMUSG00000009876
AA Change: T56I

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:COX4 32 171 4.2e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes isoform 2 of subunit IV. Isoform 1 of subunit IV is encoded by a different gene, however, the two genes show a similar structural organization. Subunit IV is the largest nuclear encoded subunit which plays a pivotal role in COX regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display lung inflammation and decreased airway responsiveness. Females show decreased lean body mass and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Cox4i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Cox4i2 APN 2 152757036 missense probably damaging 1.00
IGL02066:Cox4i2 APN 2 152760682 missense probably damaging 1.00
R5782:Cox4i2 UTSW 2 152764811 missense probably damaging 1.00
R6922:Cox4i2 UTSW 2 152757095 missense probably benign 0.01
R7072:Cox4i2 UTSW 2 152760653 missense probably damaging 1.00
R7204:Cox4i2 UTSW 2 152760698 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGAACACGGAATGTACTGC -3'
(R):5'- ATGAGGTCAGTCCAGGTGAC -3'

Sequencing Primer
(F):5'- ACGGAATGTACTGCCTGCCTG -3'
(R):5'- TCCCTTCAGACGTGGAAGTTCAG -3'
Posted On2016-10-24